Incidental Mutation 'R6610:Cdc20b'
List |< first << previous [record 9 of 47] next >> last >|
ID525922
Institutional Source Beutler Lab
Gene Symbol Cdc20b
Ensembl Gene ENSMUSG00000078926
Gene Namecell division cycle 20B
SynonymsEG622422, EG238896
MMRRC Submission
Accession Numbers

Genbank: XM_138861

Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6610 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location113035111-113091195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113064262 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 172 (T172I)
Ref Sequence ENSEMBL: ENSMUSP00000137849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109244] [ENSMUST00000181117] [ENSMUST00000181568]
Predicted Effect probably benign
Transcript: ENSMUST00000109244
AA Change: T172I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104867
Gene: ENSMUSG00000078926
AA Change: T172I

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 517 2.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181117
AA Change: T172I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137915
Gene: ENSMUSG00000078926
AA Change: T172I

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 513 1.78e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181568
AA Change: T172I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137849
Gene: ENSMUSG00000078926
AA Change: T172I

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 431 475 2.01e-4 SMART
Meta Mutation Damage Score 0.1107 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Cdc20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Cdc20b APN 13 113059785 missense possibly damaging 0.74
IGL02603:Cdc20b APN 13 113078755 missense possibly damaging 0.88
IGL02663:Cdc20b APN 13 113056131 critical splice donor site probably null
IGL03024:Cdc20b APN 13 113091042 missense possibly damaging 0.58
IGL03379:Cdc20b APN 13 113081202 missense probably damaging 1.00
H8930:Cdc20b UTSW 13 113083966 missense probably damaging 1.00
R0207:Cdc20b UTSW 13 113078612 missense probably damaging 1.00
R0347:Cdc20b UTSW 13 113059827 missense probably damaging 0.97
R0448:Cdc20b UTSW 13 113078657 missense probably damaging 1.00
R0499:Cdc20b UTSW 13 113055950 missense probably benign 0.00
R1573:Cdc20b UTSW 13 113055944 missense probably benign 0.26
R1651:Cdc20b UTSW 13 113078724 nonsense probably null
R1786:Cdc20b UTSW 13 113081134 missense probably damaging 1.00
R1929:Cdc20b UTSW 13 113071917 missense probably benign 0.07
R2118:Cdc20b UTSW 13 113078698 missense probably benign 0.30
R3436:Cdc20b UTSW 13 113078699 missense probably damaging 0.99
R3508:Cdc20b UTSW 13 113081042 missense possibly damaging 0.80
R3837:Cdc20b UTSW 13 113084008 missense probably damaging 1.00
R4050:Cdc20b UTSW 13 113064285 missense probably benign
R4521:Cdc20b UTSW 13 113081191 missense probably damaging 1.00
R4786:Cdc20b UTSW 13 113078734 missense probably damaging 1.00
R6079:Cdc20b UTSW 13 113084042 missense probably damaging 1.00
R6814:Cdc20b UTSW 13 113083975 missense probably damaging 1.00
R6872:Cdc20b UTSW 13 113083975 missense probably damaging 1.00
R6887:Cdc20b UTSW 13 113078653 missense possibly damaging 0.88
R7144:Cdc20b UTSW 13 113083371 missense probably benign 0.36
R7579:Cdc20b UTSW 13 113037048 intron probably null
R7770:Cdc20b UTSW 13 113078659 missense probably benign 0.01
U15987:Cdc20b UTSW 13 113084042 missense probably damaging 1.00
X0064:Cdc20b UTSW 13 113059742 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- AGCCGAGTAATCCCTTCTGC -3'
(R):5'- TGATGCTGACTTAGTCCGATG -3'

Sequencing Primer
(F):5'- GAGTAATCCCTTCTGCGTGGC -3'
(R):5'- GCTGACTTAGTCCGATGAAAATAG -3'
Posted On2018-06-22