Incidental Mutation 'R6666:Il22ra1'
List |< first << previous [record 16 of 45] next >> last >|
ID526963
Institutional Source Beutler Lab
Gene Symbol Il22ra1
Ensembl Gene ENSMUSG00000037157
Gene Nameinterleukin 22 receptor, alpha 1
SynonymsIl22r
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location135728172-135752140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135750461 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 281 (H281L)
Ref Sequence ENSEMBL: ENSMUSP00000099605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102546]
Predicted Effect probably damaging
Transcript: ENSMUST00000102546
AA Change: H281L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099605
Gene: ENSMUSG00000037157
AA Change: H281L

DomainStartEndE-ValueType
Pfam:Tissue_fac 4 106 1.1e-29 PFAM
Pfam:Interfer-bind 119 214 7.5e-7 PFAM
transmembrane domain 227 249 N/A INTRINSIC
Meta Mutation Damage Score 0.1731 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class II cytokine receptor family, and has been shown to be a receptor for interleukin 22 (IL22). IL22 receptor is a protein complex that consists of this protein and interleukin 10 receptor, beta (IL10BR/CRFB4), a subunit also shared by the receptor complex for interleukin 10 (IL10). This gene and interleukin 28 receptor, alpha (IL28RA) form a cytokine receptor gene cluster in the chromosomal region 1p36. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Il22ra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Il22ra1 APN 4 135751084 missense possibly damaging 0.84
IGL01480:Il22ra1 APN 4 135744801 missense probably benign 0.03
IGL02533:Il22ra1 APN 4 135744723 missense possibly damaging 0.94
R0137:Il22ra1 UTSW 4 135751006 missense probably benign 0.00
R0196:Il22ra1 UTSW 4 135734245 missense possibly damaging 0.67
R1647:Il22ra1 UTSW 4 135750460 missense probably damaging 0.98
R1800:Il22ra1 UTSW 4 135748160 missense probably benign 0.10
R1901:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1902:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1903:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1906:Il22ra1 UTSW 4 135751233 missense probably damaging 1.00
R4278:Il22ra1 UTSW 4 135750713 missense possibly damaging 0.93
R4404:Il22ra1 UTSW 4 135737431 missense possibly damaging 0.56
R5001:Il22ra1 UTSW 4 135733104 missense probably damaging 1.00
R7054:Il22ra1 UTSW 4 135751162 missense probably benign 0.00
R7615:Il22ra1 UTSW 4 135737459 missense probably benign 0.16
R7644:Il22ra1 UTSW 4 135733035 missense probably damaging 1.00
R7754:Il22ra1 UTSW 4 135734250 missense probably benign 0.01
R7808:Il22ra1 UTSW 4 135750796 missense possibly damaging 0.93
R8024:Il22ra1 UTSW 4 135734278 missense probably benign 0.43
Z1177:Il22ra1 UTSW 4 135737406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCTTAACAACCTTCTCAGAAG -3'
(R):5'- TACCTGAGGCGCATAGGAAG -3'

Sequencing Primer
(F):5'- AAAGATATTGGGTCTCTGGCTTCCAC -3'
(R):5'- ACAGTGTCTGCTGAGCTGGC -3'
Posted On2018-07-23