Mutagenetix > Incidental Mutation

Incidental Mutation 'R6666:Scnn1g'

526977

Institutional Source

Beutler Lab

Gene Symbol

Scnn1g

Ensembl Gene

ENSMUSG00000000216

Gene Name

sodium channel, nonvoltage-gated 1 gamma

Synonyms

ENaC gamma

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.667) question?

Stock #

R6666 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121734479-121768475 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 121767388 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 603 (D603N)

Ref Sequence

ENSEMBL: ENSMUSP00000000221 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000221]

AlphaFold

Q9WU39

Predicted Effect

probably benign
Transcript: ENSMUST00000000221
AA Change: D603N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: D603N

Domain	Start	End	E-Value	Type
Pfam:ASC	32	558	6.4e-91	PFAM
low complexity region	618	631	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	C	A	10: 21,593,329		probably null	Het
Arhgap24	A	G	5: 102,552,297		probably null	Het
Atp12a	G	T	14: 56,373,364	V322L	probably benign	Het
Capza1	A	C	3: 104,828,606		probably null	Het
Cela3a	A	T	4: 137,403,864	S188T	probably benign	Het
Cplx1	G	T	5: 108,520,165	Y123*	probably null	Het
Ddias	A	T	7: 92,858,081	D875E	probably benign	Het
Dnah3	T	C	7: 120,070,949	E715G	probably benign	Het
Fam83e	A	G	7: 45,727,002	T380A	probably benign	Het
Fancd2	T	C	6: 113,585,509	V1270A	probably damaging	Het
Foxh1	A	G	15: 76,668,413	F367S	probably damaging	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gprc5a	A	G	6: 135,079,475	I307V	probably benign	Het
Gtpbp3	A	G	8: 71,490,938	D212G	possibly damaging	Het
Helb	A	G	10: 120,084,951	V1029A	probably damaging	Het
Il22ra1	A	T	4: 135,750,461	H281L	probably damaging	Het
Il2rb	TAGTCA	TAGTCAGTCA	15: 78,481,834		probably null	Het
Itga3	T	C	11: 95,065,826	T170A	probably benign	Het
Kdm3a	T	C	6: 71,611,990	E345G	probably benign	Het
Kif11	T	C	19: 37,409,766	I680T	probably benign	Het
Klhl28	C	T	12: 64,943,527	D547N	probably benign	Het
Limk2	T	A	11: 3,360,493	E49D	probably damaging	Het
Lmbrd2	T	A	15: 9,151,569	F120I	probably benign	Het
Mefv	T	A	16: 3,707,998	N802Y	possibly damaging	Het
Ms4a2	C	T	19: 11,618,423	S168N	probably benign	Het
Myct1	T	C	10: 5,604,333	S67P	probably damaging	Het
Myh4	A	G	11: 67,251,812	E933G	probably damaging	Het
Naif1	C	A	2: 32,454,851	T189K	probably damaging	Het
Nppb	A	G	4: 147,986,006	I11V	probably benign	Het
Nr3c1	T	C	18: 39,487,147	D29G	probably damaging	Het
Nrcam	A	G	12: 44,571,555	Y782C	probably damaging	Het
Olfr1154	T	A	2: 87,903,508	H56L	probably damaging	Het
Olfr366	A	T	2: 37,220,319	I277F	probably damaging	Het
Olfr558	T	C	7: 102,709,928		probably null	Het
Parp1	A	G	1: 180,585,951	T375A	probably benign	Het
Pcdhgb1	G	T	18: 37,681,493	E346*	probably null	Het
Pds5b	G	T	5: 150,778,166	S754I	probably damaging	Het
Slitrk5	A	G	14: 111,680,102	D386G	probably damaging	Het
Trmt1	T	C	8: 84,698,454	L493P	probably damaging	Het
Vrk1	A	G	12: 106,058,651	E262G	probably damaging	Het
Wfs1	T	C	5: 36,967,619	T567A	possibly damaging	Het
Zbtb11	A	T	16: 56,006,252	K846I	probably damaging	Het
Zfp318	A	G	17: 46,409,214	T1113A	probably benign	Het
Zfp654	A	T	16: 64,786,233	S535R	probably benign	Het

Other mutations in Scnn1g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Scnn1g	APN	7	121740437	missense	probably benign	0.00
IGL01824:Scnn1g	APN	7	121766293	missense	probably benign	0.00
IGL02133:Scnn1g	APN	7	121743699	missense	probably damaging	1.00
IGL02529:Scnn1g	APN	7	121742446	splice site	probably benign
IGL02814:Scnn1g	APN	7	121740365	missense	probably damaging	1.00
IGL03091:Scnn1g	APN	7	121746683	missense	probably damaging	1.00
IGL03253:Scnn1g	APN	7	121737933	nonsense	probably null
PIT4504001:Scnn1g	UTSW	7	121742331	missense	probably benign	0.30
R0230:Scnn1g	UTSW	7	121746761	splice site	probably benign
R0324:Scnn1g	UTSW	7	121740555	missense	possibly damaging	0.62
R0367:Scnn1g	UTSW	7	121746579	splice site	probably benign
R0534:Scnn1g	UTSW	7	121767424	missense	probably benign	0.00
R1747:Scnn1g	UTSW	7	121760463	missense	probably damaging	0.99
R2004:Scnn1g	UTSW	7	121738188	nonsense	probably null
R2197:Scnn1g	UTSW	7	121767296	missense	probably damaging	1.00
R4396:Scnn1g	UTSW	7	121740427	missense	probably benign	0.01
R4804:Scnn1g	UTSW	7	121763080	frame shift	probably null
R4805:Scnn1g	UTSW	7	121746602	missense	probably damaging	1.00
R5219:Scnn1g	UTSW	7	121766266	missense	probably damaging	1.00
R5757:Scnn1g	UTSW	7	121738215	missense	probably damaging	1.00
R5882:Scnn1g	UTSW	7	121767358	missense	possibly damaging	0.79
R5910:Scnn1g	UTSW	7	121738095	missense	probably damaging	0.99
R6381:Scnn1g	UTSW	7	121767499	missense	probably benign	0.00
R6735:Scnn1g	UTSW	7	121742263	missense	probably benign	0.02
R6813:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6860:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6887:Scnn1g	UTSW	7	121760444	missense	probably benign	0.01
R7289:Scnn1g	UTSW	7	121738081	nonsense	probably null
R7488:Scnn1g	UTSW	7	121763434	missense	probably benign	0.00
R7630:Scnn1g	UTSW	7	121760481	missense	probably damaging	1.00
R7888:Scnn1g	UTSW	7	121743655	missense	probably damaging	0.97
R7917:Scnn1g	UTSW	7	121743693	missense	probably damaging	1.00
R9051:Scnn1g	UTSW	7	121742343	missense	possibly damaging	0.86
R9312:Scnn1g	UTSW	7	121740595	missense	probably benign	0.00
Z1177:Scnn1g	UTSW	7	121760475	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAACTTTGGTGGACAGCTCGG -3'
(R):5'- GAGTCTCCTCAAACCATGACTG -3'

Sequencing Primer
(F):5'- CCTGTGGATGAGCTGCTC -3'
(R):5'- AAACCATGACTGTTTTCCAATCC -3'

Posted On

2018-07-23