Incidental Mutation 'R6695:Muc15'
ID528525
Institutional Source Beutler Lab
Gene Symbol Muc15
Ensembl Gene ENSMUSG00000050808
Gene Namemucin 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location110721340-110739527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110731271 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 17 (L17F)
Ref Sequence ENSEMBL: ENSMUSP00000106646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090332] [ENSMUST00000099623] [ENSMUST00000111016] [ENSMUST00000111017] [ENSMUST00000140777]
Predicted Effect probably damaging
Transcript: ENSMUST00000090332
AA Change: L17F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087805
Gene: ENSMUSG00000050808
AA Change: L17F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Mucin15 21 331 2.3e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099623
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111016
AA Change: L17F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106645
Gene: ENSMUSG00000050808
AA Change: L17F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
low complexity region 163 181 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111017
AA Change: L17F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106646
Gene: ENSMUSG00000050808
AA Change: L17F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
low complexity region 163 181 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140777
SMART Domains Protein: ENSMUSP00000122387
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 40 141 5.7e-24 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Muc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01978:Muc15 APN 2 110731596 missense probably benign 0.00
IGL02547:Muc15 APN 2 110731305 missense probably damaging 0.97
IGL02751:Muc15 APN 2 110731773 missense probably benign 0.14
IGL03100:Muc15 APN 2 110731594 missense probably damaging 0.99
IGL03188:Muc15 APN 2 110731699 missense probably benign 0.14
R0684:Muc15 UTSW 2 110733815 missense possibly damaging 0.95
R1472:Muc15 UTSW 2 110731560 missense probably damaging 1.00
R1582:Muc15 UTSW 2 110737472 missense probably benign 0.16
R1661:Muc15 UTSW 2 110733898 nonsense probably null
R1665:Muc15 UTSW 2 110733898 nonsense probably null
R1725:Muc15 UTSW 2 110731246 missense probably damaging 0.96
R1815:Muc15 UTSW 2 110731258 missense probably damaging 1.00
R1892:Muc15 UTSW 2 110737352 nonsense probably null
R2022:Muc15 UTSW 2 110731476 missense probably benign 0.00
R4546:Muc15 UTSW 2 110737499 missense probably damaging 0.97
R4953:Muc15 UTSW 2 110731272 missense probably damaging 0.99
R4984:Muc15 UTSW 2 110731573 missense probably damaging 1.00
R5858:Muc15 UTSW 2 110731798 missense probably damaging 1.00
R6046:Muc15 UTSW 2 110731441 nonsense probably null
R7468:Muc15 UTSW 2 110731517 missense probably benign 0.02
R7725:Muc15 UTSW 2 110731798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCGAACTTCATGGCACTGG -3'
(R):5'- ATTCAAAGGAGAAGGAGTTGTCACC -3'

Sequencing Primer
(F):5'- CATGGCACTGGTTTAAATCCAC -3'
(R):5'- GTCACCATGAGATTGGAGATATCAC -3'
Posted On2018-07-24