Incidental Mutation 'R6695:Rad9b'
ID528533
Institutional Source Beutler Lab
Gene Symbol Rad9b
Ensembl Gene ENSMUSG00000038569
Gene NameRAD9 checkpoint clamp component B
SynonymsA630082N15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location122323223-122354233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122351691 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 43 (N43S)
Ref Sequence ENSEMBL: ENSMUSP00000036177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049009] [ENSMUST00000111729] [ENSMUST00000117263] [ENSMUST00000117868] [ENSMUST00000118765] [ENSMUST00000118830] [ENSMUST00000144268] [ENSMUST00000145821] [ENSMUST00000154686] [ENSMUST00000155671]
Predicted Effect probably damaging
Transcript: ENSMUST00000049009
AA Change: N43S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036177
Gene: ENSMUSG00000038569
AA Change: N43S

DomainStartEndE-ValueType
Pfam:Rad9 14 271 1.8e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111729
SMART Domains Protein: ENSMUSP00000107358
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117263
SMART Domains Protein: ENSMUSP00000113868
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 14 271 1.1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117868
SMART Domains Protein: ENSMUSP00000113345
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 1 143 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118765
SMART Domains Protein: ENSMUSP00000112579
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
PDB:1W24|A 1 65 7e-42 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000118830
SMART Domains Protein: ENSMUSP00000113525
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 6 162 1.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132785
Predicted Effect probably benign
Transcript: ENSMUST00000144268
SMART Domains Protein: ENSMUSP00000117334
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 1 64 6.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145821
SMART Domains Protein: ENSMUSP00000123593
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 11 124 1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149600
SMART Domains Protein: ENSMUSP00000120843
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 1 85 4.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154686
Predicted Effect probably benign
Transcript: ENSMUST00000155671
SMART Domains Protein: ENSMUSP00000121020
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 1 158 3.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200653
Meta Mutation Damage Score 0.2105 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, decreased forebrain and somite cell proliferation, and increased cellular sensitivity to gamma irradiation and mitomycin C. Mice heterozygous for a knock-out allele exhibit reduced embryonic, fetal, and early postnatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Rad9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Rad9b APN 5 122344247 missense probably benign 0.01
IGL02375:Rad9b APN 5 122333342 missense possibly damaging 0.71
R0027:Rad9b UTSW 5 122351723 unclassified probably benign
R0027:Rad9b UTSW 5 122351723 unclassified probably benign
R0103:Rad9b UTSW 5 122331527 missense probably damaging 0.99
R0103:Rad9b UTSW 5 122331527 missense probably damaging 0.99
R0975:Rad9b UTSW 5 122334257 splice site probably null
R2006:Rad9b UTSW 5 122339779 missense possibly damaging 0.74
R2265:Rad9b UTSW 5 122351342 missense probably damaging 0.98
R4818:Rad9b UTSW 5 122339776 missense probably damaging 1.00
R5392:Rad9b UTSW 5 122351578 missense probably damaging 1.00
R6041:Rad9b UTSW 5 122351352 missense probably damaging 0.99
R6109:Rad9b UTSW 5 122344297 missense probably damaging 1.00
R6133:Rad9b UTSW 5 122339768 missense possibly damaging 0.79
R6566:Rad9b UTSW 5 122352567 missense probably damaging 1.00
R7295:Rad9b UTSW 5 122334278 missense possibly damaging 0.95
R7299:Rad9b UTSW 5 122352614 missense possibly damaging 0.87
R7301:Rad9b UTSW 5 122352614 missense possibly damaging 0.87
Z1088:Rad9b UTSW 5 122333372 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTGTTAAGCCCTACAAAAGGAG -3'
(R):5'- TTACGGTATCAGAGCTTGAGAGTATAG -3'

Sequencing Primer
(F):5'- AGTATCACTCATCGTGGC -3'
(R):5'- CATGTGCAAGTTCAGTGC -3'
Posted On2018-07-24