Incidental Mutation 'R7725:Muc15'
ID595431
Institutional Source Beutler Lab
Gene Symbol Muc15
Ensembl Gene ENSMUSG00000050808
Gene Namemucin 15
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location110721340-110739527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110731798 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 193 (D193G)
Ref Sequence ENSEMBL: ENSMUSP00000106646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090332] [ENSMUST00000099623] [ENSMUST00000111016] [ENSMUST00000111017] [ENSMUST00000140777]
Predicted Effect probably damaging
Transcript: ENSMUST00000090332
AA Change: D193G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087805
Gene: ENSMUSG00000050808
AA Change: D193G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Mucin15 21 331 2.3e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099623
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111016
AA Change: D193G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106645
Gene: ENSMUSG00000050808
AA Change: D193G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
low complexity region 163 181 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111017
AA Change: D193G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106646
Gene: ENSMUSG00000050808
AA Change: D193G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
low complexity region 163 181 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140777
SMART Domains Protein: ENSMUSP00000122387
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 40 141 5.7e-24 PFAM
Meta Mutation Damage Score 0.1992 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Muc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01978:Muc15 APN 2 110731596 missense probably benign 0.00
IGL02547:Muc15 APN 2 110731305 missense probably damaging 0.97
IGL02751:Muc15 APN 2 110731773 missense probably benign 0.14
IGL03100:Muc15 APN 2 110731594 missense probably damaging 0.99
IGL03188:Muc15 APN 2 110731699 missense probably benign 0.14
R0684:Muc15 UTSW 2 110733815 missense possibly damaging 0.95
R1472:Muc15 UTSW 2 110731560 missense probably damaging 1.00
R1582:Muc15 UTSW 2 110737472 missense probably benign 0.16
R1661:Muc15 UTSW 2 110733898 nonsense probably null
R1665:Muc15 UTSW 2 110733898 nonsense probably null
R1725:Muc15 UTSW 2 110731246 missense probably damaging 0.96
R1815:Muc15 UTSW 2 110731258 missense probably damaging 1.00
R1892:Muc15 UTSW 2 110737352 nonsense probably null
R2022:Muc15 UTSW 2 110731476 missense probably benign 0.00
R4546:Muc15 UTSW 2 110737499 missense probably damaging 0.97
R4953:Muc15 UTSW 2 110731272 missense probably damaging 0.99
R4984:Muc15 UTSW 2 110731573 missense probably damaging 1.00
R5858:Muc15 UTSW 2 110731798 missense probably damaging 1.00
R6046:Muc15 UTSW 2 110731441 nonsense probably null
R6695:Muc15 UTSW 2 110731271 missense probably damaging 1.00
R7468:Muc15 UTSW 2 110731517 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAAATCCTTTACAGGTCTCCGAAC -3'
(R):5'- CCCCAGAATGCCACTCTTTG -3'

Sequencing Primer
(F):5'- AGGTCTCCGAACATTCCAATTC -3'
(R):5'- GAGATTCCTCTCTAGCCTT -3'
Posted On2019-11-12