Incidental Mutation 'R6709:Mpz'
List |< first << previous [record 30 of 58] next >> last >|
ID529033
Institutional Source Beutler Lab
Gene Symbol Mpz
Ensembl Gene ENSMUSG00000056569
Gene Namemyelin protein zero
SynonymsMpp, P0
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6709 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location171150711-171161130 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 171150732 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070758] [ENSMUST00000081560] [ENSMUST00000111334] [ENSMUST00000111336] [ENSMUST00000155798]
Predicted Effect probably benign
Transcript: ENSMUST00000070758
SMART Domains Protein: ENSMUSP00000066701
Gene: ENSMUSG00000056569

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGv 45 129 1.39e-11 SMART
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Myelin-PO_C 184 248 4.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081560
SMART Domains Protein: ENSMUSP00000080273
Gene: ENSMUSG00000058076

DomainStartEndE-ValueType
Pfam:Sdh_cyt 12 132 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111334
SMART Domains Protein: ENSMUSP00000106966
Gene: ENSMUSG00000056569

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
IGv 45 129 1.39e-11 SMART
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Myelin-PO_C 179 248 4.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111336
SMART Domains Protein: ENSMUSP00000106968
Gene: ENSMUSG00000058076

DomainStartEndE-ValueType
Pfam:Sdh_cyt 46 166 2.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155798
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This gene is specifically expressed in Schwann cells of the peripheral nervous system and encodes a type I transmembrane glycoprotein that is a major structural protein of the peripheral myelin sheath. The encoded protein contains a large hydrophobic extracellular domain and a smaller basic intracellular domain, which are essential for the formation and stabilization of the multilamellar structure of the compact myelin. Mutations in the orthologous gene in human are associated with myelinating neuropathies. A recent study showed that two isoforms are produced from the same mRNA by use of alternative in-frame translation termination codons via a stop codon readthrough mechanism. Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit premature death, infertility, neurological behavior defects, and demyelination. Mice homozygous for a knock-out allele exhibit abnormal myelination and neurological behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,554,517 D36G possibly damaging Het
Actn1 T A 12: 80,193,644 D223V probably damaging Het
Adgre1 A T 17: 57,406,917 N201Y probably benign Het
Agbl4 T A 4: 111,566,782 probably benign Het
Atg4d T C 9: 21,268,648 Y272H probably damaging Het
Ccdc39 T C 3: 33,830,093 T367A possibly damaging Het
Ceacam2 T C 7: 25,529,837 T293A possibly damaging Het
Col19a1 C T 1: 24,282,496 G977E probably damaging Het
Csnka2ip A T 16: 64,478,569 H33Q possibly damaging Het
Cyp3a44 A T 5: 145,778,092 probably null Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dnah12 A G 14: 26,872,749 D3492G probably damaging Het
Eepd1 A T 9: 25,482,868 T143S probably benign Het
Eml2 A G 7: 19,206,211 *650W probably null Het
Etv1 C T 12: 38,783,797 T19I possibly damaging Het
Fam133b T C 5: 3,569,059 probably benign Het
Fgd4 T C 16: 16,484,481 H70R probably benign Het
Galnt11 C T 5: 25,248,853 R26C probably damaging Het
Gm136 T A 4: 34,755,884 Y43F probably damaging Het
Gm17409 A T 2: 58,471,076 probably null Het
Gm5591 A G 7: 38,522,075 I190T probably benign Het
Hils1 T A 11: 94,967,946 S22R possibly damaging Het
Htra1 C T 7: 130,936,218 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints8 A T 4: 11,221,117 Y753N possibly damaging Het
L3mbtl3 G A 10: 26,282,797 T651I unknown Het
Ltb4r2 A C 14: 55,762,533 T204P possibly damaging Het
Ltbp3 G A 19: 5,747,857 probably null Het
Mlxip A T 5: 123,447,276 I616F possibly damaging Het
Myh11 A G 16: 14,223,494 probably null Het
Myo7a A G 7: 98,054,699 L1949P probably damaging Het
Olfm2 A G 9: 20,672,713 Y116H probably damaging Het
Olfr328 T C 11: 58,552,036 M68V probably benign Het
Olfr750 A T 14: 51,070,829 L188H probably damaging Het
Pde4d T G 13: 109,948,279 L470R probably damaging Het
Plxna2 T A 1: 194,789,766 N1013K probably benign Het
Ptpn13 A C 5: 103,586,756 Q2118P probably benign Het
Pwwp2a C G 11: 43,704,727 L240V probably damaging Het
Reep2 T C 18: 34,846,210 L196P probably benign Het
Shank1 A T 7: 44,354,176 N1765I probably benign Het
Slc25a13 A G 6: 6,073,440 S473P possibly damaging Het
Slc33a1 C A 3: 63,944,701 M450I possibly damaging Het
Slc45a2 A G 15: 11,001,130 Y105C possibly damaging Het
Slc4a11 A T 2: 130,684,696 L812Q probably damaging Het
Sox6 T C 7: 115,701,789 probably null Het
Ssfa2 A G 2: 79,644,932 T412A probably benign Het
Sv2b A T 7: 75,124,139 M528K probably benign Het
Syngr4 A G 7: 45,888,698 V82A probably benign Het
Tmem185b G A 1: 119,526,874 V122I probably benign Het
Trdn A G 10: 33,464,591 D607G probably benign Het
Trim10 T A 17: 36,872,370 I186N probably damaging Het
Trp53i11 A T 2: 93,199,818 M157L probably benign Het
Ubr3 C A 2: 70,013,092 H1559N probably damaging Het
Usp25 A C 16: 77,083,932 E727A probably benign Het
Vmn2r42 T A 7: 8,192,619 R509S probably benign Het
Vmn2r69 T C 7: 85,411,861 N172D probably benign Het
Zfp14 T C 7: 30,038,132 Y476C probably damaging Het
Other mutations in Mpz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Mpz APN 1 171160002 missense possibly damaging 0.84
IGL03051:Mpz APN 1 171158811 missense probably damaging 1.00
Half-pint UTSW 1 171159635 critical splice donor site probably null
taz UTSW 1 171158810 missense probably damaging 1.00
R0279:Mpz UTSW 1 171159929 splice site probably benign
R0791:Mpz UTSW 1 171158774 missense possibly damaging 0.85
R1164:Mpz UTSW 1 171158439 missense possibly damaging 0.92
R1368:Mpz UTSW 1 171159964 missense probably damaging 1.00
R4043:Mpz UTSW 1 171159771 splice site probably benign
R4857:Mpz UTSW 1 171158810 missense probably damaging 1.00
R5682:Mpz UTSW 1 171158894 missense possibly damaging 0.62
R7089:Mpz UTSW 1 171159635 critical splice donor site probably null
R7748:Mpz UTSW 1 171159940 critical splice acceptor site probably null
R7888:Mpz UTSW 1 171159635 critical splice donor site probably null
R7971:Mpz UTSW 1 171159635 critical splice donor site probably null
R8023:Mpz UTSW 1 171160033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGACTAATTCAGGTTCCCC -3'
(R):5'- GGTAAACGCACTAACGGTAAC -3'

Sequencing Primer
(F):5'- TAATTCAGGTTCCCCCAACGG -3'
(R):5'- AACCACTCGGCGATTTTGG -3'
Posted On2018-07-24