Incidental Mutation 'R6725:Ankrd40'
ID529830
Institutional Source Beutler Lab
Gene Symbol Ankrd40
Ensembl Gene ENSMUSG00000020864
Gene Nameankyrin repeat domain 40
Synonyms1110011C06Rik, 5530600A18Rik, Gcap15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6725 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94328001-94341841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 94334815 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 224 (V224G)
Ref Sequence ENSEMBL: ENSMUSP00000103448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021227] [ENSMUST00000051221] [ENSMUST00000107818] [ENSMUST00000149867]
Predicted Effect probably benign
Transcript: ENSMUST00000021227
AA Change: V224G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021227
Gene: ENSMUSG00000020864
AA Change: V224G

DomainStartEndE-ValueType
ANK 9 38 7.29e2 SMART
ANK 43 72 3.57e-6 SMART
low complexity region 144 168 N/A INTRINSIC
low complexity region 234 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051221
AA Change: V224G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000061637
Gene: ENSMUSG00000020864
AA Change: V224G

DomainStartEndE-ValueType
ANK 9 38 7.29e2 SMART
ANK 43 72 3.57e-6 SMART
low complexity region 144 168 N/A INTRINSIC
low complexity region 234 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107818
AA Change: V224G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103448
Gene: ENSMUSG00000020864
AA Change: V224G

DomainStartEndE-ValueType
ANK 9 38 7.29e2 SMART
ANK 43 72 3.57e-6 SMART
low complexity region 144 168 N/A INTRINSIC
low complexity region 234 251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124087
Predicted Effect probably benign
Transcript: ENSMUST00000149867
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,743,201 Y623C probably damaging Het
Adgrv1 T C 13: 81,437,557 E4596G probably damaging Het
Adgrv1 A T 13: 81,493,210 C3267S probably damaging Het
Ap3s2 C T 7: 79,920,642 probably benign Het
Apip T A 2: 103,092,525 D229E possibly damaging Het
Atp2b4 C T 1: 133,706,987 R1168H probably benign Het
Bcan T C 3: 87,995,484 K329R possibly damaging Het
Camk1g T C 1: 193,350,320 D261G possibly damaging Het
Ccdc30 T A 4: 119,331,599 Q490L probably damaging Het
Ccdc83 A G 7: 90,247,053 W103R probably damaging Het
Ctsl T A 13: 64,366,623 R69* probably null Het
Dchs1 C T 7: 105,758,793 R1944H probably damaging Het
Fgb T C 3: 83,043,791 Y305C probably damaging Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Gal3st2 T A 1: 93,873,702 S27T probably benign Het
Galnt13 A G 2: 54,855,232 D228G probably damaging Het
Gk5 A T 9: 96,155,470 T346S probably benign Het
Gnrhr T C 5: 86,185,313 I233V probably damaging Het
Greb1 T C 12: 16,688,567 Y1465C probably damaging Het
H6pd A G 4: 149,996,358 L10P probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ighv7-4 A T 12: 114,222,869 D94E probably damaging Het
Lamb3 T C 1: 193,304,582 Y59H probably benign Het
Msantd1 C T 5: 34,921,421 T100I probably damaging Het
Msx3 T A 7: 140,048,746 probably benign Het
Mttp C A 3: 138,107,238 A559S probably damaging Het
Myh1 C G 11: 67,201,893 D4E probably damaging Het
Olfr1018 A G 2: 85,823,790 K273R probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1295 C T 2: 111,564,907 C179Y probably damaging Het
Olfr596 A T 7: 103,310,354 D211V probably damaging Het
Pcdhac1 T C 18: 37,090,328 Y65H probably damaging Het
Pcdhga8 A T 18: 37,727,262 Y457F probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pja2 A T 17: 64,289,967 M514K probably damaging Het
Plcxd2 T C 16: 45,972,125 N284D probably damaging Het
Polr3d A T 14: 70,441,137 M129K probably benign Het
Ppp1r42 T G 1: 9,999,507 E110A probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prelid2 A G 18: 41,912,449 I132T possibly damaging Het
Sergef G A 7: 46,632,667 probably null Het
Slc24a2 C A 4: 87,226,882 probably null Het
Stxbp3 A T 3: 108,827,600 D24E possibly damaging Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Thsd7a G A 6: 12,555,631 H85Y possibly damaging Het
Tlr2 T A 3: 83,838,296 E160V probably benign Het
Tmem171 A T 13: 98,692,170 C157* probably null Het
Trpm3 T C 19: 22,926,028 Y1051H probably damaging Het
Vmn2r28 A G 7: 5,488,409 F280L probably benign Het
Xpo7 A T 14: 70,676,813 Y748N probably damaging Het
Zan T C 5: 137,438,520 S2024G unknown Het
Zfhx2 A T 14: 55,064,082 Y2148* probably null Het
Zscan4-ps1 T C 7: 11,065,979 T328A probably benign Het
Other mutations in Ankrd40
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0621:Ankrd40 UTSW 11 94339607 unclassified probably null
R2873:Ankrd40 UTSW 11 94333945 missense possibly damaging 0.62
R4817:Ankrd40 UTSW 11 94339633 missense probably benign 0.00
R4931:Ankrd40 UTSW 11 94334821 missense probably benign 0.41
R5026:Ankrd40 UTSW 11 94339724 unclassified probably benign
R5504:Ankrd40 UTSW 11 94328327 missense probably benign 0.31
R5891:Ankrd40 UTSW 11 94334863 missense probably damaging 1.00
R6089:Ankrd40 UTSW 11 94333925 missense probably damaging 1.00
R7789:Ankrd40 UTSW 11 94334709 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATAGCTCACCTCCATTGCTC -3'
(R):5'- TAGACAGATCTTGGAACTTTTCCC -3'

Sequencing Primer
(F):5'- ACAGAAACCCCTTTGCTAGG -3'
(R):5'- CTAAACATCACTCTCCTGCT -3'
Posted On2018-08-01