Incidental Mutation 'R6725:Ctsl'
ID529833
Institutional Source Beutler Lab
Gene Symbol Ctsl
Ensembl Gene ENSMUSG00000021477
Gene Namecathepsin L
Synonymsmajor excreted protein, 1190035F06Rik, Cat L, MEP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6725 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location64359337-64370890 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 64366623 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 69 (R69*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021933] [ENSMUST00000220737] [ENSMUST00000222462] [ENSMUST00000222517] [ENSMUST00000223494]
Predicted Effect probably null
Transcript: ENSMUST00000021933
AA Change: R214*
SMART Domains Protein: ENSMUSP00000021933
Gene: ENSMUSG00000021477
AA Change: R214*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 1.98e-23 SMART
Pept_C1 114 332 1.67e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220617
Predicted Effect probably benign
Transcript: ENSMUST00000220737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221966
Predicted Effect probably null
Transcript: ENSMUST00000222462
AA Change: R158*
Predicted Effect probably null
Transcript: ENSMUST00000222517
AA Change: R214*
Predicted Effect probably null
Transcript: ENSMUST00000222971
AA Change: R69*
Predicted Effect probably benign
Transcript: ENSMUST00000223494
Meta Mutation Damage Score 0.9704 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the activation peptide and the cathepsin L1 heavy and light chains. The mature enzyme appears to be important in embryonic development through its processing of histone H3 and may play a role in disease progression in a model of kidney disease. Homozygous knockout mice for this gene exhibit hair loss, skin thickening, bone and heart defects, and enhanced susceptibility to bacterial infection. A pseudogene of this gene has been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for mutant alleles may show partial or complete hair-loss, skin defects, impaired T cell maturation, dilated cardiomyopathy, and high postnatal mortality. Mutant males for some alleles show both normal and atrophic seminiferous tubules and reduced sperm production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,743,201 Y623C probably damaging Het
Adgrv1 T C 13: 81,437,557 E4596G probably damaging Het
Adgrv1 A T 13: 81,493,210 C3267S probably damaging Het
Ankrd40 T G 11: 94,334,815 V224G probably benign Het
Ap3s2 C T 7: 79,920,642 probably benign Het
Apip T A 2: 103,092,525 D229E possibly damaging Het
Atp2b4 C T 1: 133,706,987 R1168H probably benign Het
Bcan T C 3: 87,995,484 K329R possibly damaging Het
Camk1g T C 1: 193,350,320 D261G possibly damaging Het
Ccdc30 T A 4: 119,331,599 Q490L probably damaging Het
Ccdc83 A G 7: 90,247,053 W103R probably damaging Het
Dchs1 C T 7: 105,758,793 R1944H probably damaging Het
Fgb T C 3: 83,043,791 Y305C probably damaging Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Gal3st2 T A 1: 93,873,702 S27T probably benign Het
Galnt13 A G 2: 54,855,232 D228G probably damaging Het
Gk5 A T 9: 96,155,470 T346S probably benign Het
Gnrhr T C 5: 86,185,313 I233V probably damaging Het
Greb1 T C 12: 16,688,567 Y1465C probably damaging Het
H6pd A G 4: 149,996,358 L10P probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ighv7-4 A T 12: 114,222,869 D94E probably damaging Het
Lamb3 T C 1: 193,304,582 Y59H probably benign Het
Msantd1 C T 5: 34,921,421 T100I probably damaging Het
Msx3 T A 7: 140,048,746 probably benign Het
Mttp C A 3: 138,107,238 A559S probably damaging Het
Myh1 C G 11: 67,201,893 D4E probably damaging Het
Olfr1018 A G 2: 85,823,790 K273R probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1295 C T 2: 111,564,907 C179Y probably damaging Het
Olfr596 A T 7: 103,310,354 D211V probably damaging Het
Pcdhac1 T C 18: 37,090,328 Y65H probably damaging Het
Pcdhga8 A T 18: 37,727,262 Y457F probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pja2 A T 17: 64,289,967 M514K probably damaging Het
Plcxd2 T C 16: 45,972,125 N284D probably damaging Het
Polr3d A T 14: 70,441,137 M129K probably benign Het
Ppp1r42 T G 1: 9,999,507 E110A probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prelid2 A G 18: 41,912,449 I132T possibly damaging Het
Sergef G A 7: 46,632,667 probably null Het
Slc24a2 C A 4: 87,226,882 probably null Het
Stxbp3 A T 3: 108,827,600 D24E possibly damaging Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Thsd7a G A 6: 12,555,631 H85Y possibly damaging Het
Tlr2 T A 3: 83,838,296 E160V probably benign Het
Tmem171 A T 13: 98,692,170 C157* probably null Het
Trpm3 T C 19: 22,926,028 Y1051H probably damaging Het
Vmn2r28 A G 7: 5,488,409 F280L probably benign Het
Xpo7 A T 14: 70,676,813 Y748N probably damaging Het
Zan T C 5: 137,438,520 S2024G unknown Het
Zfhx2 A T 14: 55,064,082 Y2148* probably null Het
Zscan4-ps1 T C 7: 11,065,979 T328A probably benign Het
Other mutations in Ctsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ctsl APN 13 64368168 missense probably damaging 1.00
IGL02895:Ctsl APN 13 64366512 missense probably damaging 0.97
mauvais UTSW 13 64364102 splice site probably null
patch UTSW 13 64366623 nonsense probably null
G1patch:Ctsl UTSW 13 64366623 nonsense probably null
R0518:Ctsl UTSW 13 64365218 missense possibly damaging 0.75
R0521:Ctsl UTSW 13 64365218 missense possibly damaging 0.75
R1546:Ctsl UTSW 13 64367879 missense probably damaging 1.00
R2096:Ctsl UTSW 13 64369026 critical splice donor site probably null
R5690:Ctsl UTSW 13 64365208 missense probably damaging 1.00
R5804:Ctsl UTSW 13 64366488 missense probably damaging 1.00
R6182:Ctsl UTSW 13 64367972 missense probably damaging 0.99
R6670:Ctsl UTSW 13 64364102 splice site probably null
R6886:Ctsl UTSW 13 64365147 splice site probably null
R7502:Ctsl UTSW 13 64367068 missense probably damaging 1.00
R8828:Ctsl UTSW 13 64366500 missense probably damaging 1.00
R8947:Ctsl UTSW 13 64367026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGTCAGGGAGGTGCTAATTC -3'
(R):5'- GGCTTTGTTTTCAGAAAAGGAAGC -3'

Sequencing Primer
(F):5'- GGAGGTGCTAATTCTGACCATTACC -3'
(R):5'- CCAGATGTGGTTTTCAGAGTTCATAC -3'
Posted On2018-08-01