Incidental Mutation 'R6743:Zmynd10'
ID532745
Institutional Source Beutler Lab
Gene Symbol Zmynd10
Ensembl Gene ENSMUSG00000010044
Gene Namezinc finger, MYND domain containing 10
SynonymsBlu
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R6743 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107547298-107551319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107547880 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 58 (I58T)
Ref Sequence ENSEMBL: ENSMUSP00000010188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010188] [ENSMUST00000010201] [ENSMUST00000093786] [ENSMUST00000122225] [ENSMUST00000156198] [ENSMUST00000193303] [ENSMUST00000195370]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010188
AA Change: I58T

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000010188
Gene: ENSMUSG00000010044
AA Change: I58T

DomainStartEndE-ValueType
Pfam:zf-MYND 394 430 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000010201
SMART Domains Protein: ENSMUSP00000010201
Gene: ENSMUSG00000010057

DomainStartEndE-ValueType
Pfam:NPR2 5 279 1.7e-75 PFAM
Pfam:NPR2 269 373 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093786
SMART Domains Protein: ENSMUSP00000091301
Gene: ENSMUSG00000010067

DomainStartEndE-ValueType
C1 44 101 4.7e-7 SMART
low complexity region 168 185 N/A INTRINSIC
RA 194 288 6.26e-24 SMART
PDB:4LGD|H 289 334 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000122225
SMART Domains Protein: ENSMUSP00000113252
Gene: ENSMUSG00000010067

DomainStartEndE-ValueType
C1 44 105 1.92e-3 SMART
low complexity region 172 189 N/A INTRINSIC
RA 198 292 6.26e-24 SMART
Pfam:Nore1-SARAH 299 338 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156198
SMART Domains Protein: ENSMUSP00000117722
Gene: ENSMUSG00000010067

DomainStartEndE-ValueType
Blast:C1 44 83 6e-24 BLAST
SCOP:d1ptq__ 52 82 5e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193303
Predicted Effect probably benign
Transcript: ENSMUST00000195370
SMART Domains Protein: ENSMUSP00000141746
Gene: ENSMUSG00000010057

DomainStartEndE-ValueType
Pfam:NPR2 2 156 1.2e-52 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a MYND-type zinc finger domain that likely functions in assembly of the dynein motor. Mutations in this gene can cause primary ciliary dyskinesia. This gene is also considered a tumor suppressor gene and is often mutated, deleted, or hypermethylated and silenced in cancer cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,108,347 R339C possibly damaging Het
Adamts6 G A 13: 104,428,928 G721R probably damaging Het
Adnp2 A G 18: 80,128,059 V1045A probably benign Het
Agbl3 T C 6: 34,846,953 I856T probably benign Het
Anapc1 T A 2: 128,684,534 K115* probably null Het
Arc A G 15: 74,671,787 S196P probably benign Het
Atp10a T C 7: 58,797,814 I768T possibly damaging Het
Blk C T 14: 63,384,926 R55H probably benign Het
Ccdc105 G A 10: 78,752,892 T28M probably benign Het
Ccdc158 T C 5: 92,662,146 S168G probably benign Het
Cda G T 4: 138,338,942 T128K probably benign Het
Celsr1 T A 15: 85,907,598 T2601S probably damaging Het
Dmxl1 T C 18: 49,880,780 V1545A possibly damaging Het
Dst T A 1: 34,270,890 N6264K probably damaging Het
Ednra T C 8: 77,675,089 S191G probably damaging Het
Elk3 A T 10: 93,265,050 S280T possibly damaging Het
Etnk1 A G 6: 143,180,617 I63V possibly damaging Het
Fscb A G 12: 64,471,573 S1040P unknown Het
Gm14295 T G 2: 176,810,627 C637G probably damaging Het
Gm5114 T C 7: 39,408,573 T541A probably benign Het
Man2c1 T C 9: 57,135,565 F240L probably benign Het
Map2 A T 1: 66,415,607 I1219L probably benign Het
Map3k13 A G 16: 21,892,423 Y152C probably damaging Het
Mettl7a3 A G 15: 100,335,242 K105E probably benign Het
Morc1 G A 16: 48,502,320 A327T probably damaging Het
Myo3a A T 2: 22,361,664 Y553F probably benign Het
Myo9b T A 8: 71,352,159 probably null Het
Olfr125 A C 17: 37,835,803 D268A probably damaging Het
Olfr1469 C T 19: 13,410,593 T8I probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pde6a T A 18: 61,263,986 F634L possibly damaging Het
Pkd1l2 C A 8: 117,030,631 C1556F probably damaging Het
Prdm5 G A 6: 65,883,651 V440I probably damaging Het
Rasa2 T C 9: 96,611,440 T64A probably damaging Het
Sec24b A T 3: 130,041,232 Y106N probably damaging Het
Sfswap C T 5: 129,550,819 Q689* probably null Het
Slamf8 C T 1: 172,590,398 probably null Het
Tsr1 T C 11: 74,908,351 V786A probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Other mutations in Zmynd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Zmynd10 APN 9 107550532 missense probably damaging 0.96
R0152:Zmynd10 UTSW 9 107550945 unclassified probably null
R0749:Zmynd10 UTSW 9 107548683 missense probably damaging 0.96
R1899:Zmynd10 UTSW 9 107550037 missense probably benign 0.20
R1900:Zmynd10 UTSW 9 107550037 missense probably benign 0.20
R4111:Zmynd10 UTSW 9 107549052 nonsense probably null
R5403:Zmynd10 UTSW 9 107550586 missense possibly damaging 0.59
R5468:Zmynd10 UTSW 9 107550337 missense probably benign 0.00
R6430:Zmynd10 UTSW 9 107548712 nonsense probably null
R7117:Zmynd10 UTSW 9 107547517 missense probably benign 0.22
R7247:Zmynd10 UTSW 9 107548777 missense possibly damaging 0.95
R7291:Zmynd10 UTSW 9 107549304 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACAGGATCATGGTAGTCTTC -3'
(R):5'- TCCACTGAGGGTACAATAGGAAATG -3'

Sequencing Primer
(F):5'- GGTAGTCTTCAGTAGGATCCAACC -3'
(R):5'- ATGTAGCCAGCCAGGTACAGC -3'
Posted On2018-08-29