Incidental Mutation 'R6798:Kdm1b'
ID 533136
Institutional Source Beutler Lab
Gene Symbol Kdm1b
Ensembl Gene ENSMUSG00000038080
Gene Name lysine (K)-specific demethylase 1B
Synonyms 4632428N09Rik, Aof1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock # R6798 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 47043499-47085279 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47068536 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 484 (T484A)
Ref Sequence ENSEMBL: ENSMUSP00000038373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037025]
AlphaFold Q8CIG3
Predicted Effect probably benign
Transcript: ENSMUST00000037025
AA Change: T484A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080
AA Change: T484A

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143518
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Meta Mutation Damage Score 0.0661 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 97% (73/75)
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes are viable, grossly normal and male mice are fertile; however, heterozygous progeny of homozygous null mothers display severe placental defects, embryonic growth impairment, neural tube defects and pericardial edema, and do not survive past E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310046K23Rik G C 3: 92,532,936 C65W unknown Het
Abcb1a T C 5: 8,732,364 Y916H probably damaging Het
Adam11 A G 11: 102,777,008 I740V probably damaging Het
Adam22 A T 5: 8,160,784 D161E probably damaging Het
Agap3 A G 5: 24,498,282 probably null Het
Ank2 T C 3: 126,944,264 probably benign Het
Aspm T A 1: 139,468,685 H867Q possibly damaging Het
Aurkaip1 T C 4: 155,832,739 probably null Het
BC048507 A C 13: 67,863,564 D20A probably benign Het
Cacna1a G A 8: 84,611,602 A1704T probably damaging Het
Cep152 A C 2: 125,566,527 probably null Het
Cep19 T C 16: 32,104,049 probably null Het
Chd9 A T 8: 91,051,554 E2731V possibly damaging Het
Chrd T C 16: 20,734,306 L139P probably damaging Het
Cit A G 5: 115,926,526 E489G possibly damaging Het
Clcn7 A G 17: 25,159,760 N720D probably damaging Het
Col6a3 T C 1: 90,795,009 probably null Het
Dchs2 T A 3: 83,348,286 Y2430N probably damaging Het
Dpy30 A G 17: 74,307,756 I64T probably damaging Het
Eif2b3 G T 4: 117,066,458 W290L probably benign Het
Epha6 T G 16: 60,605,064 E62A possibly damaging Het
Epha6 C T 16: 60,605,065 E62K possibly damaging Het
Epha8 C T 4: 136,945,669 R268Q probably benign Het
Fam155a G A 8: 9,770,205 Q272* probably null Het
Fbxw17 C A 13: 50,433,264 probably null Het
Fndc8 C T 11: 82,892,391 T66I probably benign Het
Frmpd1 A G 4: 45,284,850 T1224A probably benign Het
Gcm2 T C 13: 41,105,885 D36G probably damaging Het
Glt28d2 T C 3: 85,871,989 D59G probably benign Het
Gm4788 T C 1: 139,698,121 T813A probably benign Het
Gorasp1 T C 9: 119,929,597 D243G probably benign Het
Gtsf1l T C 2: 163,087,471 K31E probably benign Het
Heatr5a A G 12: 51,881,265 V1816A probably benign Het
Il10ra T C 9: 45,256,432 K274E probably damaging Het
Il1rl2 T C 1: 40,365,240 I507T probably damaging Het
Jak3 T G 8: 71,680,971 F408V probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Map9 T G 3: 82,380,164 L31W probably damaging Het
Micalcl T C 7: 112,376,059 probably benign Het
Mt1 A G 8: 94,179,888 probably benign Het
Myo18b T C 5: 112,761,386 I1964V probably damaging Het
Nod1 A T 6: 54,944,611 C241S probably damaging Het
Nrxn1 T A 17: 90,629,950 D685V probably damaging Het
Olfr504 T A 7: 108,565,760 K12* probably null Het
Olfr695 T C 7: 106,714,195 Y162C probably damaging Het
Olfr730 A G 14: 50,187,127 V30A probably benign Het
Olfr96 T G 17: 37,225,806 L227R probably damaging Het
Oog1 A T 12: 87,608,839 probably null Het
P4htm T A 9: 108,582,918 N219I possibly damaging Het
Pcif1 T C 2: 164,885,791 L168P possibly damaging Het
Pde4dip A G 3: 97,888,534 V46A probably benign Het
Pias1 T C 9: 62,892,169 T480A probably benign Het
Prkd2 A T 7: 16,849,203 K297* probably null Het
Prl7d1 T A 13: 27,709,397 probably null Het
Pxdc1 G T 13: 34,652,425 A4E possibly damaging Het
Rcor1 A G 12: 111,039,886 probably benign Het
Rev3l A T 10: 39,854,763 D2761V probably damaging Het
Scgb1b7 A G 7: 31,712,981 T61A probably damaging Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Setd4 C A 16: 93,589,953 V286F probably damaging Het
Slc22a29 A G 19: 8,160,604 S536P probably benign Het
Snx25 T C 8: 46,033,773 H977R probably damaging Het
Spint5 T A 2: 164,717,140 C95* probably null Het
Srgap1 T C 10: 121,925,904 D113G probably damaging Het
Stxbp2 T A 8: 3,641,180 S476T probably benign Het
Tg A G 15: 66,678,839 T273A probably damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trappc10 A G 10: 78,188,831 Y1155H probably benign Het
Trpm2 T A 10: 77,914,740 N1341Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfand1 T G 3: 10,346,176 K67T probably benign Het
Zfand4 A C 6: 116,328,253 K214Q probably benign Het
Zfp653 A T 9: 22,057,372 V465E probably damaging Het
Zswim8 A G 14: 20,715,992 Y782C probably damaging Het
Other mutations in Kdm1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Kdm1b APN 13 47068540 missense probably benign 0.01
IGL00924:Kdm1b APN 13 47068480 missense probably benign
IGL01553:Kdm1b APN 13 47080548 missense probably damaging 0.96
IGL01663:Kdm1b APN 13 47073737 missense probably damaging 0.99
IGL02385:Kdm1b APN 13 47068506 missense possibly damaging 0.49
IGL02505:Kdm1b APN 13 47060855 missense probably damaging 1.00
IGL02826:Kdm1b APN 13 47080467 missense probably damaging 1.00
IGL03257:Kdm1b APN 13 47049266 missense probably damaging 1.00
R0052:Kdm1b UTSW 13 47064117 missense probably damaging 1.00
R0319:Kdm1b UTSW 13 47053719 missense probably benign
R0426:Kdm1b UTSW 13 47064244 splice site probably benign
R0599:Kdm1b UTSW 13 47058810 missense possibly damaging 0.47
R0764:Kdm1b UTSW 13 47068603 missense possibly damaging 0.70
R1163:Kdm1b UTSW 13 47071922 missense probably benign 0.02
R1543:Kdm1b UTSW 13 47068521 missense probably damaging 0.99
R1584:Kdm1b UTSW 13 47064054 missense probably damaging 1.00
R1627:Kdm1b UTSW 13 47064231 critical splice donor site probably null
R1669:Kdm1b UTSW 13 47068548 missense probably damaging 1.00
R1758:Kdm1b UTSW 13 47060768 missense probably benign 0.00
R1860:Kdm1b UTSW 13 47049190 missense probably benign 0.03
R1907:Kdm1b UTSW 13 47064120 missense probably benign 0.00
R2225:Kdm1b UTSW 13 47064088 frame shift probably null
R2239:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2271:Kdm1b UTSW 13 47064088 frame shift probably null
R2302:Kdm1b UTSW 13 47064088 frame shift probably null
R2303:Kdm1b UTSW 13 47064088 frame shift probably null
R2380:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2442:Kdm1b UTSW 13 47062975 missense probably benign 0.32
R3022:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3054:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3545:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3546:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4094:Kdm1b UTSW 13 47063020 missense probably damaging 1.00
R4419:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4420:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4502:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4547:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4785:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4793:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4804:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4882:Kdm1b UTSW 13 47060893 missense probably benign
R4906:Kdm1b UTSW 13 47063144 critical splice donor site probably null
R4965:Kdm1b UTSW 13 47074367 missense probably damaging 0.98
R5039:Kdm1b UTSW 13 47077486 missense probably damaging 1.00
R5098:Kdm1b UTSW 13 47062991 missense probably damaging 1.00
R5265:Kdm1b UTSW 13 47062969 missense probably benign 0.35
R5541:Kdm1b UTSW 13 47079196 missense probably damaging 1.00
R5814:Kdm1b UTSW 13 47063146 splice site probably null
R6046:Kdm1b UTSW 13 47079253 missense possibly damaging 0.92
R6903:Kdm1b UTSW 13 47074404 missense probably benign 0.00
R7831:Kdm1b UTSW 13 47050622 missense probably benign 0.17
R7973:Kdm1b UTSW 13 47077446 missense probably benign 0.00
R8181:Kdm1b UTSW 13 47051901 critical splice donor site probably null
R8248:Kdm1b UTSW 13 47071878 intron probably benign
R8821:Kdm1b UTSW 13 47064141 missense possibly damaging 0.94
R8831:Kdm1b UTSW 13 47064141 missense possibly damaging 0.94
R8842:Kdm1b UTSW 13 47078356 missense probably damaging 1.00
R8861:Kdm1b UTSW 13 47064106 missense probably benign 0.02
R8885:Kdm1b UTSW 13 47053708 nonsense probably null
R9038:Kdm1b UTSW 13 47049294 missense probably benign 0.07
R9132:Kdm1b UTSW 13 47071982 missense probably benign 0.05
R9268:Kdm1b UTSW 13 47064229 missense probably benign 0.00
R9616:Kdm1b UTSW 13 47080554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGCCGGAAGCTGTTGTC -3'
(R):5'- CTGCAGAGTTCAGCCAAAGG -3'

Sequencing Primer
(F):5'- GAGTTATTAGCGTCATCATGAGAGC -3'
(R):5'- GGATGCATGTAAGGACCGGC -3'
Posted On 2018-08-29