Incidental Mutation 'R6937:Epn1'
ID540338
Institutional Source Beutler Lab
Gene Symbol Epn1
Ensembl Gene ENSMUSG00000035203
Gene Nameepsin 1
SynonymsIbp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6937 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location5080235-5098178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5089944 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 85 (I85T)
Ref Sequence ENSEMBL: ENSMUSP00000146638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045277] [ENSMUST00000098845] [ENSMUST00000146317] [ENSMUST00000208634]
Predicted Effect probably damaging
Transcript: ENSMUST00000045277
AA Change: I85T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043340
Gene: ENSMUSG00000035203
AA Change: I85T

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098845
AA Change: I85T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096445
Gene: ENSMUSG00000035203
AA Change: I85T

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146317
AA Change: I85T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116571
Gene: ENSMUSG00000035203
AA Change: I85T

DomainStartEndE-ValueType
Pfam:ENTH 17 90 7.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208634
AA Change: I85T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.8568 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epsin protein family. The encoded protein binds clathrin and is involved in the endocytosis of clathrin-coated vesicles. Loss of function of this gene is associated with reduced tumor growth and progression in certain cancer types. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. Mice homozygous null for both Epn1 and Epn2 display defects in angiogenic vascular remodeling, impaired somitogenesis and extensive cell death in the nervous tissue, resulting in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,387,020 V613A probably benign Het
Cdh23 A T 10: 60,487,114 L337Q probably damaging Het
Chrna6 A G 8: 27,407,027 L274P probably damaging Het
Ciita G A 16: 10,512,491 probably null Het
Csnka2ip A T 16: 64,478,695 probably benign Het
Ddx60 G A 8: 62,037,069 D1691N probably damaging Het
Dnah7b T C 1: 46,195,120 I1441T probably damaging Het
Dock4 T C 12: 40,834,635 S1713P probably benign Het
Ep400 T C 5: 110,711,152 probably benign Het
Eri2 T C 7: 119,786,789 K228E probably damaging Het
Garem1 C T 18: 21,147,770 A510T probably benign Het
Gfm2 T A 13: 97,163,064 probably null Het
Gm37596 T C 3: 93,692,216 N282S probably benign Het
Gm4858 A G 3: 93,074,110 H145R probably benign Het
Hnrnpd T C 5: 99,963,770 T321A probably benign Het
Htr2a A T 14: 74,645,164 I197F probably damaging Het
Krtap2-4 T A 11: 99,614,473 probably benign Het
Lcn3 C A 2: 25,767,811 Y179* probably null Het
Mak A T 13: 41,048,102 M261K probably damaging Het
March7 A G 2: 60,240,966 T605A probably damaging Het
Mcm4 A C 16: 15,636,335 F83V probably benign Het
Myo18b T C 5: 112,802,392 N1546S probably benign Het
Nckap1 T A 2: 80,508,716 K989N probably damaging Het
Ndufaf5 A G 2: 140,181,602 D119G probably damaging Het
Olfr846 A T 9: 19,360,689 V222D probably damaging Het
Pcdh1 T C 18: 38,203,475 T36A possibly damaging Het
Pitpna C T 11: 75,603,731 T100I possibly damaging Het
Pmf1 A T 3: 88,399,189 L102Q probably damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Robo3 A G 9: 37,429,880 L10P probably benign Het
Serpinb6a T C 13: 33,918,818 I241V possibly damaging Het
St14 A T 9: 31,129,660 probably null Het
Stat6 T C 10: 127,658,702 probably null Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tgfbrap1 A T 1: 43,051,904 V687E probably damaging Het
Trim30d A T 7: 104,483,427 S68T probably damaging Het
Ttn A G 2: 76,832,909 probably benign Het
Ugt3a1 A T 15: 9,292,072 D97V probably benign Het
Ugt8a G A 3: 125,915,601 probably benign Het
Vmn1r184 A T 7: 26,267,325 K165N probably benign Het
Vmn2r86 T A 10: 130,448,654 I523F probably damaging Het
Wapl G A 14: 34,722,354 V588I probably benign Het
Wdr7 C T 18: 63,791,867 P974S probably benign Het
Zfp975 T C 7: 42,665,056 D31G possibly damaging Het
Other mutations in Epn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Epn1 APN 7 5095036 missense probably benign 0.19
IGL03126:Epn1 APN 7 5095685 missense probably benign 0.01
epsilon UTSW 7 5095048 missense probably benign
R1074:Epn1 UTSW 7 5095048 missense probably benign
R1365:Epn1 UTSW 7 5093370 missense probably benign 0.05
R1848:Epn1 UTSW 7 5089998 missense probably damaging 1.00
R2041:Epn1 UTSW 7 5083875 missense probably damaging 0.99
R2237:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R2238:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R2239:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R4255:Epn1 UTSW 7 5097638 missense probably damaging 1.00
R4324:Epn1 UTSW 7 5097211 missense probably benign 0.07
R4542:Epn1 UTSW 7 5093981 missense possibly damaging 0.63
R4703:Epn1 UTSW 7 5095148 missense probably damaging 0.99
R4740:Epn1 UTSW 7 5090013 missense probably damaging 1.00
R4845:Epn1 UTSW 7 5093909 missense possibly damaging 0.94
R5838:Epn1 UTSW 7 5097166 nonsense probably null
R5952:Epn1 UTSW 7 5093912 missense probably damaging 1.00
R6251:Epn1 UTSW 7 5095926 missense probably damaging 1.00
R6251:Epn1 UTSW 7 5095936 missense probably damaging 1.00
R6296:Epn1 UTSW 7 5090123 missense probably damaging 0.98
R6710:Epn1 UTSW 7 5097304 missense probably damaging 0.99
R7196:Epn1 UTSW 7 5093381 missense possibly damaging 0.68
R7420:Epn1 UTSW 7 5097688 missense possibly damaging 0.77
X0065:Epn1 UTSW 7 5095093 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATAGTCCGTGCTGGTGTCAC -3'
(R):5'- AGTGGGAGAGAAACCTCACC -3'

Sequencing Primer
(F):5'- TATCCATGGGAGCACACATTGTG -3'
(R):5'- GAGAGAAACCTCACCCGTGG -3'
Posted On2018-11-06