Incidental Mutation 'R6652:Wnt10a'
ID543564
Institutional Source Beutler Lab
Gene Symbol Wnt10a
Ensembl Gene ENSMUSG00000026167
Gene Namewingless-type MMTV integration site family, member 10A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6652 (G1)
Quality Score47.0072
Status Validated
Chromosome1
Chromosomal Location74791516-74804179 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 74803454 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000006718]
Predicted Effect probably damaging
Transcript: ENSMUST00000006718
AA Change: N363S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006718
Gene: ENSMUSG00000026167
AA Change: N363S

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
WNT1 63 417 4.97e-143 SMART
Predicted Effect probably null
Transcript: ENSMUST00000187238
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is strongly expressed in the cell lines of promyelocytic leukemia and Burkitt's lymphoma. In addition, it and another family member, the WNT6 gene, are strongly coexpressed in colorectal cancer cell lines. The gene overexpression may play key roles in carcinogenesis through activation of the WNT-beta-catenin-TCF signaling pathway. This gene and the WNT6 gene are clustered in the chromosome 2q35 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit taurodontism, supernumerary molars, small molars and misshapened crowns. Mice homozygous for a conditional allele activated in Krt14+ cells also exhibit decreased basal cell proliferation affecting the tongue, sweat glands and nails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cwf19l1 T C 19: 44,114,699 D359G probably benign Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Espnl A C 1: 91,344,699 I594L probably benign Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fhdc1 T C 3: 84,464,324 Y108C probably damaging Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grap2 A T 15: 80,648,522 N297Y probably damaging Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Nadsyn1 A T 7: 143,811,218 M250K probably benign Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr220 G A 1: 174,449,061 C146Y probably damaging Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stn1 T C 19: 47,507,578 T334A probably benign Het
Stoml1 A G 9: 58,256,734 D112G probably damaging Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Ubap2 A T 4: 41,196,743 N872K possibly damaging Het
Vezt A G 10: 93,970,279 F757L probably damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zdhhc19 T C 16: 32,497,229 F48S probably damaging Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Wnt10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0347:Wnt10a UTSW 1 74793543 missense probably damaging 0.97
R2312:Wnt10a UTSW 1 74803430 missense possibly damaging 0.74
R3941:Wnt10a UTSW 1 74803497 splice site probably null
R4683:Wnt10a UTSW 1 74803137 missense unknown
R4719:Wnt10a UTSW 1 74803603 missense probably damaging 1.00
R5218:Wnt10a UTSW 1 74793595 missense probably benign
R5244:Wnt10a UTSW 1 74803295 missense probably damaging 0.99
R5813:Wnt10a UTSW 1 74800596 missense probably damaging 1.00
R7278:Wnt10a UTSW 1 74793482 missense possibly damaging 0.92
R7637:Wnt10a UTSW 1 74793474 nonsense probably null
R8293:Wnt10a UTSW 1 74803217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACATGCGGCGTAAGTGC -3'
(R):5'- AGCTTGGGTCTGCTCACTTG -3'

Sequencing Primer
(F):5'- CGGCGTAAGTGCAAATGCC -3'
(R):5'- TCACTTGCAGACGCTGAC -3'
Posted On2019-03-06