Incidental Mutation 'R6652:Olfr220'
ID528080
Institutional Source Beutler Lab
Gene Symbol Olfr220
Ensembl Gene ENSMUSG00000066671
Gene Nameolfactory receptor 220
SynonymsEG546747, GA_x6K02SYWY4V-595-239, Olfr413-ps1, GA_x6K02T2P20D-20731742-20730694, MOR103-17, MOR103-13P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6652 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174442082-174451277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 174449061 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 146 (C146Y)
Ref Sequence ENSEMBL: ENSMUSP00000141919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085861] [ENSMUST00000194229]
Predicted Effect probably damaging
Transcript: ENSMUST00000085861
AA Change: C146Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083023
Gene: ENSMUSG00000066671
AA Change: C146Y

DomainStartEndE-ValueType
Pfam:7tm_4 36 314 1.2e-51 PFAM
Pfam:7tm_1 46 295 3.6e-25 PFAM
low complexity region 315 325 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194229
AA Change: C146Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141919
Gene: ENSMUSG00000066671
AA Change: C146Y

DomainStartEndE-ValueType
Pfam:7tm_1 46 295 6e-33 PFAM
Pfam:7tm_4 144 288 1.4e-44 PFAM
low complexity region 315 325 N/A INTRINSIC
Meta Mutation Damage Score 0.3317 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Cwf19l1 T C 19: 44,114,699 D359G probably benign Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Espnl A C 1: 91,344,699 I594L probably benign Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fhdc1 T C 3: 84,464,324 Y108C probably damaging Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grap2 A T 15: 80,648,522 N297Y probably damaging Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Nadsyn1 A T 7: 143,811,218 M250K probably benign Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stn1 T C 19: 47,507,578 T334A probably benign Het
Stoml1 A G 9: 58,256,734 D112G probably damaging Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Ubap2 A T 4: 41,196,743 N872K possibly damaging Het
Vezt A G 10: 93,970,279 F757L probably damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Wnt10a A G 1: 74,803,454 probably null Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zdhhc19 T C 16: 32,497,229 F48S probably damaging Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Olfr220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Olfr220 APN 1 174448667 missense probably benign 0.00
IGL03369:Olfr220 APN 1 174448869 missense probably damaging 1.00
R1792:Olfr220 UTSW 1 174448737 missense probably benign
R4090:Olfr220 UTSW 1 174448934 missense probably benign 0.01
R4169:Olfr220 UTSW 1 174449596 missense unknown
R4769:Olfr220 UTSW 1 174448958 missense possibly damaging 0.80
R6930:Olfr220 UTSW 1 174449111 missense probably damaging 1.00
R7237:Olfr220 UTSW 1 174449339 missense probably benign 0.05
R8039:Olfr220 UTSW 1 174449596 missense unknown
R8187:Olfr220 UTSW 1 174449272 frame shift probably null
R8518:Olfr220 UTSW 1 174449176 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCATCAGTCCCAAGATGCTG -3'
(R):5'- ACAGCAATGACCATGAGGGC -3'

Sequencing Primer
(F):5'- CAAGATGCTGGTAGACTTCCTCAG -3'
(R):5'- GAAGAAGTCTACTAGCTCTGCCTG -3'
Posted On2018-07-24