Incidental Mutation 'R7010:Pgrmc2'
ID544953
Institutional Source Beutler Lab
Gene Symbol Pgrmc2
Ensembl Gene ENSMUSG00000049940
Gene Nameprogesterone receptor membrane component 2
Synonyms5730409G06Rik, DG6, 4631434O19Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location41066326-41083046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41082633 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 121 (V121A)
Ref Sequence ENSEMBL: ENSMUSP00000056643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058578]
Predicted Effect probably damaging
Transcript: ENSMUST00000058578
AA Change: V121A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056643
Gene: ENSMUSG00000049940
AA Change: V121A

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
transmembrane domain 40 62 N/A INTRINSIC
Cyt-b5 97 195 2.62e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in the uterus exhibit early female reproductive senescence, decreased uterine NK cell number, increased endometrial gland number and uterine cysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Ano10 T C 9: 122,253,124 T494A probably damaging Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atat1 T C 17: 35,908,630 D114G probably damaging Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Camk2g T C 14: 20,741,444 S410G probably benign Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dlat T A 9: 50,657,974 K176N probably damaging Het
Dnajc12 T A 10: 63,397,280 C67S probably benign Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gmip G A 8: 69,811,400 A137T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Hook1 G T 4: 96,014,811 L512F probably damaging Het
Ighe T C 12: 113,273,141 T36A Het
Il17rc A G 6: 113,479,288 N338S possibly damaging Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Nrros T C 16: 32,143,580 T540A probably damaging Het
Olfr487 A T 7: 108,212,142 I129N probably damaging Het
Pank2 T C 2: 131,280,373 Y273H probably benign Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn1r122 A G 7: 21,133,971 V53A probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Vmn2r86 A G 10: 130,455,857 L13P probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Pgrmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Pgrmc2 APN 3 41082633 missense probably damaging 1.00
IGL03290:Pgrmc2 APN 3 41068626 utr 3 prime probably benign
R1935:Pgrmc2 UTSW 3 41083038 start gained probably benign
R1936:Pgrmc2 UTSW 3 41083038 start gained probably benign
R4694:Pgrmc2 UTSW 3 41070405 missense probably damaging 1.00
R7892:Pgrmc2 UTSW 3 41082980 missense probably damaging 0.99
R7975:Pgrmc2 UTSW 3 41082980 missense probably damaging 0.99
Z1177:Pgrmc2 UTSW 3 41070378 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTCAGCCCCAGGAAAAGCTG -3'
(R):5'- CGTAAAGCTAAGCACCCTGG -3'

Sequencing Primer
(F):5'- CTGCGAGGAGATACGGATTG -3'
(R):5'- AGATGCTGCTGAACGTGGC -3'
Posted On2019-05-13