Incidental Mutation 'R7010:Vmn2r86'
ID544973
Institutional Source Beutler Lab
Gene Symbol Vmn2r86
Ensembl Gene ENSMUSG00000092162
Gene Namevomeronasal 2, receptor 86
SynonymsEG625109
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location130445707-130455894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130455857 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 13 (L13P)
Ref Sequence ENSEMBL: ENSMUSP00000126596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170257]
Predicted Effect probably benign
Transcript: ENSMUST00000170257
AA Change: L13P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126596
Gene: ENSMUSG00000092162
AA Change: L13P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 425 1.1e-25 PFAM
Pfam:NCD3G 508 562 2.4e-19 PFAM
Pfam:7tm_3 595 829 6.4e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Ano10 T C 9: 122,253,124 T494A probably damaging Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atat1 T C 17: 35,908,630 D114G probably damaging Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Camk2g T C 14: 20,741,444 S410G probably benign Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dlat T A 9: 50,657,974 K176N probably damaging Het
Dnajc12 T A 10: 63,397,280 C67S probably benign Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gmip G A 8: 69,811,400 A137T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Hook1 G T 4: 96,014,811 L512F probably damaging Het
Ighe T C 12: 113,273,141 T36A Het
Il17rc A G 6: 113,479,288 N338S possibly damaging Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Nrros T C 16: 32,143,580 T540A probably damaging Het
Olfr487 A T 7: 108,212,142 I129N probably damaging Het
Pank2 T C 2: 131,280,373 Y273H probably benign Het
Pgrmc2 A G 3: 41,082,633 V121A probably damaging Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn1r122 A G 7: 21,133,971 V53A probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Vmn2r86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Vmn2r86 APN 10 130453026 missense probably damaging 0.99
IGL01328:Vmn2r86 APN 10 130452496 missense possibly damaging 0.78
IGL01377:Vmn2r86 APN 10 130452986 missense probably damaging 0.99
IGL01548:Vmn2r86 APN 10 130446282 missense probably benign 0.22
IGL01804:Vmn2r86 APN 10 130452989 missense probably damaging 0.99
IGL01921:Vmn2r86 APN 10 130455741 missense probably benign 0.00
IGL02406:Vmn2r86 APN 10 130448639 missense possibly damaging 0.81
IGL02625:Vmn2r86 APN 10 130452912 missense probably damaging 1.00
IGL02960:Vmn2r86 APN 10 130453767 missense possibly damaging 0.74
IGL03104:Vmn2r86 APN 10 130446632 missense probably damaging 1.00
R0408:Vmn2r86 UTSW 10 130446854 missense probably damaging 1.00
R0437:Vmn2r86 UTSW 10 130446543 missense probably damaging 1.00
R0577:Vmn2r86 UTSW 10 130452575 missense probably benign 0.04
R0726:Vmn2r86 UTSW 10 130446396 missense probably damaging 1.00
R0811:Vmn2r86 UTSW 10 130453628 missense probably benign 0.00
R0812:Vmn2r86 UTSW 10 130453628 missense probably benign 0.00
R1055:Vmn2r86 UTSW 10 130446357 missense probably damaging 1.00
R1066:Vmn2r86 UTSW 10 130446276 missense probably benign 0.01
R1199:Vmn2r86 UTSW 10 130448574 splice site probably benign
R1332:Vmn2r86 UTSW 10 130446870 missense probably damaging 1.00
R1568:Vmn2r86 UTSW 10 130453141 missense probably benign 0.09
R1866:Vmn2r86 UTSW 10 130446386 missense probably damaging 1.00
R1897:Vmn2r86 UTSW 10 130452445 missense probably damaging 1.00
R2017:Vmn2r86 UTSW 10 130446713 missense probably benign 0.39
R3162:Vmn2r86 UTSW 10 130455804 missense probably damaging 0.99
R3162:Vmn2r86 UTSW 10 130455804 missense probably damaging 0.99
R3858:Vmn2r86 UTSW 10 130455725 missense probably benign
R4049:Vmn2r86 UTSW 10 130447097 missense probably damaging 0.98
R4378:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4411:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4413:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4422:Vmn2r86 UTSW 10 130452976 missense possibly damaging 0.87
R4738:Vmn2r86 UTSW 10 130447070 missense probably damaging 0.99
R4767:Vmn2r86 UTSW 10 130455737 missense probably benign 0.00
R4872:Vmn2r86 UTSW 10 130453591 missense probably damaging 0.98
R4880:Vmn2r86 UTSW 10 130453615 missense probably benign 0.33
R5092:Vmn2r86 UTSW 10 130446587 missense probably damaging 1.00
R5421:Vmn2r86 UTSW 10 130446936 missense probably benign 0.41
R6007:Vmn2r86 UTSW 10 130453666 missense probably damaging 1.00
R6330:Vmn2r86 UTSW 10 130446527 missense probably benign 0.05
R6355:Vmn2r86 UTSW 10 130455894 start codon destroyed probably damaging 0.98
R6397:Vmn2r86 UTSW 10 130446262 nonsense probably null
R6419:Vmn2r86 UTSW 10 130446926 missense probably damaging 1.00
R6933:Vmn2r86 UTSW 10 130446257 missense probably damaging 1.00
R6937:Vmn2r86 UTSW 10 130448654 missense probably damaging 1.00
R6959:Vmn2r86 UTSW 10 130446531 missense probably damaging 1.00
R7549:Vmn2r86 UTSW 10 130446828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGACAGAACACACAGTTTG -3'
(R):5'- TATCCAGGGAGCATGACATAGG -3'

Sequencing Primer
(F):5'- TAACCACACTCACTTTGCA -3'
(R):5'- TAGGATGAATGGAAAGGAACTGTTG -3'
Posted On2019-05-13