Incidental Mutation 'R7070:Adcy8'
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Nameadenylate cyclase 8
MMRRC Submission
Accession Numbers

Genbank: NM_009623; MGI: 1341110

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7070 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location64697084-64922296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64920555 bp
Amino Acid Change Asparagine to Isoleucine at position 184 (N184I)
Ref Sequence ENSEMBL: ENSMUSP00000023007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000180105] [ENSMUST00000228014]
Predicted Effect probably damaging
Transcript: ENSMUST00000023007
AA Change: N184I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: N184I

low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180105
SMART Domains Protein: ENSMUSP00000136962
Gene: ENSMUSG00000094296

low complexity region 60 87 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000228014
AA Change: N184I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,953,248 Y156H probably damaging Het
Abca13 T A 11: 9,290,701 F855I probably benign Het
Abca2 T G 2: 25,442,995 F1569V probably benign Het
Akap3 T C 6: 126,874,024 V835A probably damaging Het
Atg5 T A 10: 44,286,154 L22H probably damaging Het
Atp13a5 A G 16: 29,334,061 F196L possibly damaging Het
C1qtnf9 A G 14: 60,779,783 H254R probably damaging Het
Capza3 C T 6: 140,041,920 R82C probably damaging Het
Ccdc126 A G 6: 49,339,862 D92G probably damaging Het
Cdh12 T A 15: 21,583,829 M585K probably benign Het
Chrnb3 A T 8: 27,393,961 Y242F probably damaging Het
Cngb3 T C 4: 19,425,593 V467A possibly damaging Het
Cnot8 A G 11: 58,117,452 D248G probably benign Het
Cntn1 C T 15: 92,254,036 T452M probably damaging Het
Cygb C A 11: 116,654,025 probably benign Het
D930020B18Rik G A 10: 121,641,974 V35M probably damaging Het
Dcaf17 C T 2: 71,088,513 T477M probably benign Het
Dpp3 A T 19: 4,918,328 F239I probably benign Het
Dst T A 1: 34,275,302 V6442E probably damaging Het
Enpp2 T A 15: 54,899,289 I188F probably damaging Het
Galnt5 A G 2: 57,998,609 M74V probably benign Het
Grin2a T C 16: 9,579,424 D933G possibly damaging Het
Gtf2i T A 5: 134,282,803 E223D probably damaging Het
H2-M5 C A 17: 36,989,159 G41V possibly damaging Het
Hars2 C T 18: 36,791,112 R501* probably null Het
Heatr4 A G 12: 83,969,858 V545A probably benign Het
Hsd3b3 T A 3: 98,742,471 T179S possibly damaging Het
Ighv5-6 A G 12: 113,625,809 V17A probably damaging Het
Jak3 A G 8: 71,684,611 D772G probably damaging Het
Jakmip2 A T 18: 43,557,328 probably null Het
Kcnj15 C G 16: 95,295,831 T104S probably damaging Het
Kndc1 A G 7: 139,921,828 E927G probably damaging Het
Larp1b G T 3: 40,976,651 G275C probably damaging Het
Lyst C A 13: 13,757,444 H3552Q probably benign Het
Mast2 A T 4: 116,310,855 I960N probably benign Het
Mcee G A 7: 64,400,330 V70I possibly damaging Het
Muc16 G A 9: 18,645,923 Q3025* probably null Het
Nrg1 T A 8: 31,849,437 T45S probably damaging Het
Nutm1 T A 2: 112,249,461 H703L probably benign Het
Olfr1023 G A 2: 85,887,690 V297I probably benign Het
Olfr1354 A T 10: 78,917,268 I143L probably benign Het
Pbx1 A C 1: 168,195,768 C273G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Phf1 A G 17: 26,934,333 T42A possibly damaging Het
Pigm T A 1: 172,377,666 I323N probably damaging Het
Plcg2 G A 8: 117,596,306 R700H probably benign Het
Ptx4 G A 17: 25,122,997 A149T probably benign Het
Rab6a A G 7: 100,629,857 D68G probably damaging Het
Rcan3 C T 4: 135,416,587 E185K probably damaging Het
Rnf14 A G 18: 38,301,728 N76S possibly damaging Het
Rpf1 A T 3: 146,512,184 F192I probably damaging Het
Rps6ka1 T C 4: 133,861,448 T285A probably benign Het
Rrp8 T C 7: 105,734,876 K94E possibly damaging Het
Rsbn1 A G 3: 103,928,983 K122E probably damaging Het
Senp1 T C 15: 98,082,306 T53A possibly damaging Het
Slc23a1 T G 18: 35,621,781 D519A probably damaging Het
Slfn14 T G 11: 83,276,705 R661S probably benign Het
Snta1 T C 2: 154,381,059 E248G probably benign Het
Stk11ip C T 1: 75,527,615 H297Y probably benign Het
Synpr T A 14: 13,493,628 F76I probably damaging Het
Thegl G T 5: 77,047,277 probably null Het
Tns2 A G 15: 102,104,533 R27G possibly damaging Het
Trav5-4 C T 14: 53,704,455 S95F possibly damaging Het
Ttyh1 T C 7: 4,133,364 Y330H probably damaging Het
Ugt1a2 T A 1: 88,201,502 probably null Het
Vmn2r69 T C 7: 85,411,480 I299V probably damaging Het
Vmn2r90 T A 17: 17,704,051 D37E probably damaging Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64787367 missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64699302 missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64822313 missense probably benign 0.07
IGL01083:Adcy8 APN 15 64787342 missense probably benign 0.21
IGL01296:Adcy8 APN 15 64783779 missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64737414 missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64815321 missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64806662 missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64822220 missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64787454 missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64783984 missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64746895 critical splice donor site probably null
IGL03180:Adcy8 APN 15 64783950 missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64920267 missense probably damaging 1.00
revolutionary UTSW 15 64699387 missense probably damaging 1.00
whirligig UTSW 15 64699285 missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64822234 missense probably benign 0.38
K7894:Adcy8 UTSW 15 64822234 missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64754817 missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64699368 missense probably benign 0.29
R0119:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0129:Adcy8 UTSW 15 64747013 missense probably benign 0.18
R0299:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0573:Adcy8 UTSW 15 64822195 missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64746931 missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64716062 missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64871776 missense probably benign 0.25
R1881:Adcy8 UTSW 15 64806654 missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2014:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2015:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2164:Adcy8 UTSW 15 64920934 missense probably benign
R2228:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2241:Adcy8 UTSW 15 64699381 missense possibly damaging 0.78
R3177:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3277:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3404:Adcy8 UTSW 15 64699600 missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64871707 missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64725535 splice site probably benign
R3710:Adcy8 UTSW 15 64725535 splice site probably benign
R3778:Adcy8 UTSW 15 64746997 missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64725470 missense probably benign 0.06
R4685:Adcy8 UTSW 15 64737438 missense probably benign 0.09
R4731:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4732:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R5071:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5073:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5091:Adcy8 UTSW 15 64806704 missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64767857 missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5403:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5521:Adcy8 UTSW 15 64815350 missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64699285 missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64754866 missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64920471 missense possibly damaging 0.91
R5787:Adcy8 UTSW 15 64704218 missense probably damaging 0.98
R5839:Adcy8 UTSW 15 64716182 missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64815417 missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64817639 splice site probably null
R6338:Adcy8 UTSW 15 64920617 missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64699387 missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64737394 nonsense probably null
R6636:Adcy8 UTSW 15 64787402 missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64754886 critical splice acceptor site probably null
R7007:Adcy8 UTSW 15 64704716 missense possibly damaging 0.88
R7092:Adcy8 UTSW 15 64871770 missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64699218 missense probably benign 0.19
R7457:Adcy8 UTSW 15 64920680 missense possibly damaging 0.79
R7611:Adcy8 UTSW 15 64921033 missense probably benign
R7644:Adcy8 UTSW 15 64699369 missense possibly damaging 0.77
R7697:Adcy8 UTSW 15 64747001 missense probably benign
R7735:Adcy8 UTSW 15 64783780 missense probably benign 0.10
R7789:Adcy8 UTSW 15 64871774 nonsense probably null
R7860:Adcy8 UTSW 15 64699473 missense probably damaging 0.97
R7894:Adcy8 UTSW 15 64920205 missense possibly damaging 0.60
R7948:Adcy8 UTSW 15 64815350 missense possibly damaging 0.80
R7966:Adcy8 UTSW 15 64702090 missense probably damaging 1.00
R8024:Adcy8 UTSW 15 64920246 missense probably damaging 1.00
R8097:Adcy8 UTSW 15 64871862 splice site probably null
R8158:Adcy8 UTSW 15 64783806 missense probably benign 0.32
R8463:Adcy8 UTSW 15 64921025 missense probably benign
R8474:Adcy8 UTSW 15 64704789 missense probably damaging 0.98
Z1176:Adcy8 UTSW 15 64725518 missense probably benign 0.16
Z1177:Adcy8 UTSW 15 64699177 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-05-13