Incidental Mutation 'R3277:Adcy8'
ID 258290
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Name adenylate cyclase 8
Synonyms AC8
Accession Numbers

Genbank: NM_009623; MGI: 1341110

Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R3277 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 64697084-64922296 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 64699159 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 1242 (G1242S)
Ref Sequence ENSEMBL: ENSMUSP00000023007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000228014]
AlphaFold P97490
Predicted Effect probably benign
Transcript: ENSMUST00000023007
AA Change: G1242S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: G1242S

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228014
AA Change: G1212S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,100 R553G possibly damaging Het
Adarb2 A G 13: 8,752,627 N646S probably damaging Het
Ano9 T A 7: 141,104,124 T543S probably damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Btnl9 T C 11: 49,169,676 D330G probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Cdx2 A T 5: 147,303,192 S225T probably benign Het
Clca4b T C 3: 144,911,359 I843M probably benign Het
Cntn4 G A 6: 106,437,964 probably null Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dgkb G A 12: 38,084,217 V41M probably damaging Het
Duox1 T C 2: 122,340,116 Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 probably null Het
Fbxw2 T C 2: 34,822,750 T100A probably benign Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Flg2 A T 3: 93,214,888 Q1455L unknown Het
Frrs1 T C 3: 116,899,224 F49S probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7104 A T 12: 88,285,728 noncoding transcript Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hacd4 T C 4: 88,437,510 H46R probably damaging Het
Herc2 T C 7: 56,153,428 V2175A probably benign Het
Hey1 T C 3: 8,664,891 S169G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hlf T C 11: 90,345,835 K199E probably damaging Het
Hpgd C A 8: 56,298,413 A92E probably damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kif2a A G 13: 106,976,756 I455T probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc3 G T 2: 31,908,625 G448C probably damaging Het
Ltbp1 G A 17: 75,276,480 G425D possibly damaging Het
Ltbp1 T A 17: 75,359,278 probably null Het
Mag C T 7: 30,901,648 probably null Het
Mdh1b G A 1: 63,711,531 T426M possibly damaging Het
Nr1h4 G A 10: 89,478,788 T282I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr552 T C 7: 102,604,576 V74A possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Parp9 T C 16: 35,948,208 S20P probably damaging Het
Pdcd11 T C 19: 47,113,264 F963L probably damaging Het
Pwp1 C T 10: 85,882,079 L294F probably benign Het
Radil A G 5: 142,506,856 L339P probably damaging Het
Raver1 G A 9: 21,079,277 P316S possibly damaging Het
Rell1 A G 5: 63,926,987 probably null Het
Rxrg A G 1: 167,635,700 D257G possibly damaging Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Unc13a A C 8: 71,629,695 C1642G probably benign Het
Usp36 C T 11: 118,276,759 probably null Het
Wrn A G 8: 33,317,554 M292T probably damaging Het
Zfp423 A G 8: 87,782,331 Y462H probably damaging Het
Zscan5b T A 7: 6,231,346 Y124N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64787367 missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64699302 missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64822313 missense probably benign 0.07
IGL01083:Adcy8 APN 15 64787342 missense probably benign 0.21
IGL01296:Adcy8 APN 15 64783779 missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64737414 missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64815321 missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64806662 missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64822220 missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64787454 missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64783984 missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64746895 critical splice donor site probably null
IGL03180:Adcy8 APN 15 64783950 missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64920267 missense probably damaging 1.00
revolutionary UTSW 15 64699387 missense probably damaging 1.00
whirligig UTSW 15 64699285 missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64822234 missense probably benign 0.38
K7894:Adcy8 UTSW 15 64822234 missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64754817 missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64699368 missense probably benign 0.29
R0119:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0129:Adcy8 UTSW 15 64747013 missense probably benign 0.18
R0299:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0573:Adcy8 UTSW 15 64822195 missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64746931 missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64716062 missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64871776 missense probably benign 0.25
R1881:Adcy8 UTSW 15 64806654 missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2014:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2015:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2164:Adcy8 UTSW 15 64920934 missense probably benign
R2228:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2241:Adcy8 UTSW 15 64699381 missense possibly damaging 0.78
R3177:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3404:Adcy8 UTSW 15 64699600 missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64871707 missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64725535 splice site probably benign
R3710:Adcy8 UTSW 15 64725535 splice site probably benign
R3778:Adcy8 UTSW 15 64746997 missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64725470 missense probably benign 0.06
R4685:Adcy8 UTSW 15 64737438 missense probably benign 0.09
R4731:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4732:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R5071:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5073:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5091:Adcy8 UTSW 15 64806704 missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64767857 missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5403:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5521:Adcy8 UTSW 15 64815350 missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64699285 missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64754866 missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64920471 missense possibly damaging 0.91
R5787:Adcy8 UTSW 15 64704218 missense probably damaging 0.98
R5839:Adcy8 UTSW 15 64716182 missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64815417 missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64817639 splice site probably null
R6338:Adcy8 UTSW 15 64920617 missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64699387 missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64737394 nonsense probably null
R6636:Adcy8 UTSW 15 64787402 missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64754886 critical splice acceptor site probably null
R7007:Adcy8 UTSW 15 64704716 missense possibly damaging 0.88
R7070:Adcy8 UTSW 15 64920555 missense probably damaging 1.00
R7092:Adcy8 UTSW 15 64871770 missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64699218 missense probably benign 0.19
R7457:Adcy8 UTSW 15 64920680 missense possibly damaging 0.79
R7611:Adcy8 UTSW 15 64921033 missense probably benign
R7644:Adcy8 UTSW 15 64699369 missense possibly damaging 0.77
R7697:Adcy8 UTSW 15 64747001 missense probably benign
R7735:Adcy8 UTSW 15 64783780 missense probably benign 0.10
R7789:Adcy8 UTSW 15 64871774 nonsense probably null
R7860:Adcy8 UTSW 15 64699473 missense probably damaging 0.97
R7894:Adcy8 UTSW 15 64920205 missense possibly damaging 0.60
R7948:Adcy8 UTSW 15 64815350 missense possibly damaging 0.80
R7966:Adcy8 UTSW 15 64702090 missense probably damaging 1.00
R8024:Adcy8 UTSW 15 64920246 missense probably damaging 1.00
R8097:Adcy8 UTSW 15 64871862 splice site probably null
R8158:Adcy8 UTSW 15 64783806 missense probably benign 0.32
R8463:Adcy8 UTSW 15 64921025 missense probably benign
R8474:Adcy8 UTSW 15 64704789 missense probably damaging 0.98
R8696:Adcy8 UTSW 15 64815386 missense probably benign 0.30
R8955:Adcy8 UTSW 15 64704705 missense possibly damaging 0.92
R8973:Adcy8 UTSW 15 64699135 makesense probably null
R9015:Adcy8 UTSW 15 64725357 intron probably benign
R9041:Adcy8 UTSW 15 64737438 missense probably benign 0.31
R9052:Adcy8 UTSW 15 64920915 missense probably benign 0.00
R9074:Adcy8 UTSW 15 64702091 missense probably damaging 0.96
R9183:Adcy8 UTSW 15 64822267 missense probably damaging 0.98
R9259:Adcy8 UTSW 15 64704755 missense probably damaging 1.00
R9498:Adcy8 UTSW 15 64920196 missense possibly damaging 0.88
R9522:Adcy8 UTSW 15 64920711 missense probably damaging 0.99
R9800:Adcy8 UTSW 15 64699246 missense probably benign 0.19
Z1176:Adcy8 UTSW 15 64725518 missense probably benign 0.16
Z1177:Adcy8 UTSW 15 64699177 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTTGTGCACTTGATCTTGG -3'
(R):5'- ATACTTTCTCCTGGGACGAGTC -3'

Sequencing Primer
(F):5'- GCACTTGATCTTGGATACTCAAAGAC -3'
(R):5'- TTCATCTTACCCCCAAGGAGAC -3'
Posted On 2015-01-23