Mutagenetix > Incidental Mutations

Incidental Mutation 'R3277:Adcy8'

258290

Institutional Source

Beutler Lab

Gene Symbol

Adcy8

Ensembl Gene

ENSMUSG00000022376

Gene Name

adenylate cyclase 8

Synonyms

AC8

Accession Numbers

Genbank: NM_009623; MGI: 1341110

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R3277 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64697084-64922296 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 64699159 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 1242 (G1242S)

Ref Sequence

ENSEMBL: ENSMUSP00000023007 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000228014]

Predicted Effect

probably benign
Transcript: ENSMUST00000023007
AA Change: G1242S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: G1242S

Domain	Start	End	E-Value	Type
low complexity region	52	61	N/A	INTRINSIC
low complexity region	111	123	N/A	INTRINSIC
low complexity region	185	201	N/A	INTRINSIC
low complexity region	255	271	N/A	INTRINSIC
CYCc	363	565	3.16e-63	SMART
Pfam:DUF1053	615	710	1.3e-30	PFAM
transmembrane domain	741	759	N/A	INTRINSIC
transmembrane domain	780	802	N/A	INTRINSIC
transmembrane domain	833	852	N/A	INTRINSIC
transmembrane domain	857	879	N/A	INTRINSIC
low complexity region	900	911	N/A	INTRINSIC
CYCc	940	1155	2.19e-48	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000228014
AA Change: G1212S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,472,100	R553G	possibly damaging	Het
Adarb2	A	G	13: 8,752,627	N646S	probably damaging	Het
Ano9	T	A	7: 141,104,124	T543S	probably damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Btnl9	T	C	11: 49,169,676	D330G	probably damaging	Het
Ccdc178	G	T	18: 22,067,652	A416E	possibly damaging	Het
Cdx2	A	T	5: 147,303,192	S225T	probably benign	Het
Clca4b	T	C	3: 144,911,359	I843M	probably benign	Het
Cntn4	G	A	6: 106,437,964		probably null	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dgkb	G	A	12: 38,084,217	V41M	probably damaging	Het
Duox1	T	C	2: 122,340,116	Y1206H	probably damaging	Het
Dync1i1	T	C	6: 5,972,211		probably null	Het
Fbxw2	T	C	2: 34,822,750	T100A	probably benign	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Flg2	A	T	3: 93,214,888	Q1455L	unknown	Het
Frrs1	T	C	3: 116,899,224	F49S	probably damaging	Het
Gli3	A	T	13: 15,725,982	Q1318L	probably benign	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gm7104	A	T	12: 88,285,728		noncoding transcript	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hacd4	T	C	4: 88,437,510	H46R	probably damaging	Het
Herc2	T	C	7: 56,153,428	V2175A	probably benign	Het
Hey1	T	C	3: 8,664,891	S169G	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hlf	T	C	11: 90,345,835	K199E	probably damaging	Het
Hpgd	C	A	8: 56,298,413	A92E	probably damaging	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kif2a	A	G	13: 106,976,756	I455T	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lamc3	G	T	2: 31,908,625	G448C	probably damaging	Het
Ltbp1	G	A	17: 75,276,480	G425D	possibly damaging	Het
Ltbp1	T	A	17: 75,359,278		probably null	Het
Mag	C	T	7: 30,901,648		probably null	Het
Mdh1b	G	A	1: 63,711,531	T426M	possibly damaging	Het
Nr1h4	G	A	10: 89,478,788	T282I	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1231	C	T	2: 89,303,218	V125M	possibly damaging	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr552	T	C	7: 102,604,576	V74A	possibly damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Parp9	T	C	16: 35,948,208	S20P	probably damaging	Het
Pdcd11	T	C	19: 47,113,264	F963L	probably damaging	Het
Pwp1	C	T	10: 85,882,079	L294F	probably benign	Het
Radil	A	G	5: 142,506,856	L339P	probably damaging	Het
Raver1	G	A	9: 21,079,277	P316S	possibly damaging	Het
Rell1	A	G	5: 63,926,987		probably null	Het
Rxrg	A	G	1: 167,635,700	D257G	possibly damaging	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Unc13a	A	C	8: 71,629,695	C1642G	probably benign	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Wrn	A	G	8: 33,317,554	M292T	probably damaging	Het
Zfp423	A	G	8: 87,782,331	Y462H	probably damaging	Het
Zscan5b	T	A	7: 6,231,346	Y124N	possibly damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Adcy8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00589:Adcy8	APN	15	64787367	missense	probably damaging	1.00
IGL00690:Adcy8	APN	15	64699302	missense	probably damaging	1.00
IGL00990:Adcy8	APN	15	64822313	missense	probably benign	0.07
IGL01083:Adcy8	APN	15	64787342	missense	probably benign	0.21
IGL01296:Adcy8	APN	15	64783779	missense	probably damaging	0.98
IGL01433:Adcy8	APN	15	64737414	missense	possibly damaging	0.63
IGL01584:Adcy8	APN	15	64815321	missense	probably damaging	1.00
IGL01729:Adcy8	APN	15	64806662	missense	probably damaging	1.00
IGL02023:Adcy8	APN	15	64822220	missense	probably damaging	1.00
IGL02420:Adcy8	APN	15	64787454	missense	probably damaging	1.00
IGL02613:Adcy8	APN	15	64783984	missense	possibly damaging	0.82
IGL02662:Adcy8	APN	15	64746895	critical splice donor site	probably null
IGL03180:Adcy8	APN	15	64783950	missense	possibly damaging	0.77
IGL03327:Adcy8	APN	15	64920267	missense	probably damaging	1.00
revolutionary	UTSW	15	64699387	missense	probably damaging	1.00
whirligig	UTSW	15	64699285	missense	probably damaging	1.00
F0336:Adcy8	UTSW	15	64822234	missense	probably benign	0.38
K7894:Adcy8	UTSW	15	64822234	missense	probably benign	0.38
PIT4581001:Adcy8	UTSW	15	64754817	missense	probably damaging	1.00
R0035:Adcy8	UTSW	15	64699368	missense	probably benign	0.29
R0119:Adcy8	UTSW	15	64716166	missense	probably damaging	1.00
R0129:Adcy8	UTSW	15	64747013	missense	probably benign	0.18
R0299:Adcy8	UTSW	15	64716166	missense	probably damaging	1.00
R0573:Adcy8	UTSW	15	64822195	missense	probably damaging	1.00
R0961:Adcy8	UTSW	15	64754862	missense	possibly damaging	0.91
R1203:Adcy8	UTSW	15	64746931	missense	probably damaging	1.00
R1239:Adcy8	UTSW	15	64716062	missense	probably damaging	0.98
R1615:Adcy8	UTSW	15	64871776	missense	probably benign	0.25
R1881:Adcy8	UTSW	15	64806654	missense	probably damaging	0.96
R2013:Adcy8	UTSW	15	64767878	missense	probably benign	0.00
R2014:Adcy8	UTSW	15	64767878	missense	probably benign	0.00
R2015:Adcy8	UTSW	15	64767878	missense	probably benign	0.00
R2164:Adcy8	UTSW	15	64920934	missense	probably benign
R2228:Adcy8	UTSW	15	64822207	missense	possibly damaging	0.58
R2229:Adcy8	UTSW	15	64822207	missense	possibly damaging	0.58
R2241:Adcy8	UTSW	15	64699381	missense	possibly damaging	0.78
R3177:Adcy8	UTSW	15	64699159	missense	probably benign	0.10
R3404:Adcy8	UTSW	15	64699600	missense	probably damaging	1.00
R3688:Adcy8	UTSW	15	64871707	missense	probably damaging	0.99
R3709:Adcy8	UTSW	15	64725535	splice site	probably benign
R3710:Adcy8	UTSW	15	64725535	splice site	probably benign
R3778:Adcy8	UTSW	15	64746997	missense	probably damaging	1.00
R4037:Adcy8	UTSW	15	64725470	missense	probably benign	0.06
R4685:Adcy8	UTSW	15	64737438	missense	probably benign	0.09
R4731:Adcy8	UTSW	15	64754862	missense	possibly damaging	0.91
R4732:Adcy8	UTSW	15	64754862	missense	possibly damaging	0.91
R4733:Adcy8	UTSW	15	64754862	missense	possibly damaging	0.91
R5071:Adcy8	UTSW	15	64787358	missense	probably damaging	1.00
R5073:Adcy8	UTSW	15	64787358	missense	probably damaging	1.00
R5074:Adcy8	UTSW	15	64787358	missense	probably damaging	1.00
R5091:Adcy8	UTSW	15	64806704	missense	probably damaging	1.00
R5285:Adcy8	UTSW	15	64767857	missense	possibly damaging	0.68
R5287:Adcy8	UTSW	15	64716152	missense	probably benign	0.04
R5403:Adcy8	UTSW	15	64716152	missense	probably benign	0.04
R5521:Adcy8	UTSW	15	64815350	missense	probably damaging	1.00
R5633:Adcy8	UTSW	15	64699285	missense	probably damaging	1.00
R5712:Adcy8	UTSW	15	64754866	missense	probably damaging	1.00
R5745:Adcy8	UTSW	15	64920471	missense	possibly damaging	0.91
R5787:Adcy8	UTSW	15	64704218	missense	probably damaging	0.98
R5839:Adcy8	UTSW	15	64716182	missense	probably damaging	1.00
R5890:Adcy8	UTSW	15	64815417	missense	probably damaging	1.00
R6156:Adcy8	UTSW	15	64817639	splice site	probably null
R6338:Adcy8	UTSW	15	64920617	missense	possibly damaging	0.94
R6516:Adcy8	UTSW	15	64699387	missense	probably damaging	1.00
R6525:Adcy8	UTSW	15	64737394	nonsense	probably null
R6636:Adcy8	UTSW	15	64787402	missense	probably damaging	1.00
R6823:Adcy8	UTSW	15	64754886	critical splice acceptor site	probably null
R7007:Adcy8	UTSW	15	64704716	missense	possibly damaging	0.88
R7070:Adcy8	UTSW	15	64920555	missense	probably damaging	1.00
R7092:Adcy8	UTSW	15	64871770	missense	possibly damaging	0.93
R7371:Adcy8	UTSW	15	64699218	missense	probably benign	0.19
R7457:Adcy8	UTSW	15	64920680	missense	possibly damaging	0.79
R7611:Adcy8	UTSW	15	64921033	missense	probably benign
R7644:Adcy8	UTSW	15	64699369	missense	possibly damaging	0.77
R7697:Adcy8	UTSW	15	64747001	missense	probably benign
R7735:Adcy8	UTSW	15	64783780	missense	probably benign	0.10
R7789:Adcy8	UTSW	15	64871774	nonsense	probably null
R7860:Adcy8	UTSW	15	64699473	missense	probably damaging	0.97
R7894:Adcy8	UTSW	15	64920205	missense	possibly damaging	0.60
R7948:Adcy8	UTSW	15	64815350	missense	possibly damaging	0.80
R7966:Adcy8	UTSW	15	64702090	missense	probably damaging	1.00
R8024:Adcy8	UTSW	15	64920246	missense	probably damaging	1.00
R8097:Adcy8	UTSW	15	64871862	splice site	probably null
R8158:Adcy8	UTSW	15	64783806	missense	probably benign	0.32
R8463:Adcy8	UTSW	15	64921025	missense	probably benign
R8474:Adcy8	UTSW	15	64704789	missense	probably damaging	0.98
Z1176:Adcy8	UTSW	15	64725518	missense	probably benign	0.16
Z1177:Adcy8	UTSW	15	64699177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AACTTGTGCACTTGATCTTGG -3'
(R):5'- ATACTTTCTCCTGGGACGAGTC -3'

Sequencing Primer
(F):5'- GCACTTGATCTTGGATACTCAAAGAC -3'
(R):5'- TTCATCTTACCCCCAAGGAGAC -3'

Posted On

2015-01-23