Incidental Mutation 'R7109:Olfr1425'
ID 551424
Institutional Source Beutler Lab
Gene Symbol Olfr1425
Ensembl Gene ENSMUSG00000067526
Gene Name olfactory receptor 1425
Synonyms GA_x6K02T2RE5P-2433425-2432490, MOR239-7
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7109 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 12073234-12077731 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12074212 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 140 (I140T)
Ref Sequence ENSEMBL: ENSMUSP00000151154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087828] [ENSMUST00000214918]
AlphaFold K7N659
Predicted Effect probably benign
Transcript: ENSMUST00000087828
AA Change: I141T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085130
Gene: ENSMUSG00000067526
AA Change: I141T

DomainStartEndE-ValueType
Pfam:7tm_4 30 303 9.3e-48 PFAM
Pfam:7tm_1 40 286 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214918
AA Change: I140T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T G 2: 151,473,753 K2Q probably damaging Het
Abtb2 T C 2: 103,715,515 Y903H probably benign Het
Adamtsl3 C T 7: 82,611,861 P29S Het
Alcam T A 16: 52,276,829 T355S probably damaging Het
Anapc1 A G 2: 128,674,602 V404A probably benign Het
Bst2 A G 8: 71,537,282 F49S possibly damaging Het
C1qtnf9 G C 14: 60,779,570 W183S probably benign Het
Camsap3 A G 8: 3,598,087 I132V possibly damaging Het
Cchcr1 T A 17: 35,517,941 probably null Het
Cenpk A G 13: 104,230,748 K31E probably benign Het
Cfap221 T C 1: 119,925,571 K798E possibly damaging Het
Copb2 T A 9: 98,581,280 probably null Het
Dennd1a T A 2: 38,048,792 Y102F probably damaging Het
Eif2ak4 C T 2: 118,405,051 P88S probably damaging Het
Epha6 C A 16: 59,682,668 V959F probably damaging Het
Fam193a C A 5: 34,465,821 T1251K possibly damaging Het
Herc1 A T 9: 66,481,889 Q3896L probably benign Het
Ikbip C A 10: 91,083,228 D34E probably benign Het
Insr A G 8: 3,258,481 V185A probably benign Het
Jakmip1 C T 5: 37,174,765 Q930* probably null Het
Klc1 A G 12: 111,776,865 I209V probably benign Het
Lrrk2 T A 15: 91,764,782 L1660M probably damaging Het
Mbd3l1 G T 9: 18,484,914 D112Y possibly damaging Het
Mrps2 T A 2: 28,468,246 V16E probably benign Het
Ncoa1 G A 12: 4,322,978 T141I possibly damaging Het
Ndst2 G T 14: 20,729,843 R110S probably damaging Het
Nlrp2 A G 7: 5,328,617 V260A probably damaging Het
Olfr491 A G 7: 108,317,752 N286S probably damaging Het
Olfr575 A T 7: 102,955,253 V116E probably damaging Het
Olfr828 A T 9: 18,815,608 S229T probably benign Het
Pah T C 10: 87,570,286 V262A probably damaging Het
Pcnt T G 10: 76,369,904 E2538A probably damaging Het
Pdxk T A 10: 78,446,976 I162F probably damaging Het
Plod2 T C 9: 92,573,597 F110L probably damaging Het
Pm20d2 A T 4: 33,187,186 L154Q probably damaging Het
Podxl2 C T 6: 88,843,584 V445I possibly damaging Het
Ppp1r3a A T 6: 14,719,236 W560R probably benign Het
Rasal3 A G 17: 32,392,709 S815P probably damaging Het
Rdm1 A G 11: 101,633,828 K196E probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Scn1a T C 2: 66,350,942 D79G possibly damaging Het
Slc22a21 A G 11: 53,979,503 Y119H possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Synrg C A 11: 84,039,672 A1280E possibly damaging Het
Szt2 A G 4: 118,375,479 C2396R unknown Het
Trappc3 A G 4: 126,273,933 N95S probably benign Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Ush2a T A 1: 188,381,484 D633E probably benign Het
Wasl G A 6: 24,633,187 P151S probably benign Het
Wwp2 A G 8: 107,483,356 N122S probably benign Het
Zfp51 A G 17: 21,463,569 R149G possibly damaging Het
Zfp764 A G 7: 127,404,715 S415P possibly damaging Het
Other mutations in Olfr1425
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Olfr1425 APN 19 12074057 missense probably benign 0.00
IGL02508:Olfr1425 APN 19 12073887 missense possibly damaging 0.90
IGL03183:Olfr1425 APN 19 12074028 missense probably damaging 0.98
R1164:Olfr1425 UTSW 19 12074241 nonsense probably null
R1866:Olfr1425 UTSW 19 12073819 missense probably benign 0.03
R3745:Olfr1425 UTSW 19 12074380 missense probably damaging 1.00
R4364:Olfr1425 UTSW 19 12074497 missense probably benign 0.13
R4888:Olfr1425 UTSW 19 12074315 missense probably damaging 1.00
R4962:Olfr1425 UTSW 19 12074275 missense probably damaging 1.00
R5954:Olfr1425 UTSW 19 12074083 missense possibly damaging 0.96
R6383:Olfr1425 UTSW 19 12074363 missense probably damaging 1.00
R6409:Olfr1425 UTSW 19 12074747 start gained probably benign
R6417:Olfr1425 UTSW 19 12073960 missense probably benign 0.18
R6420:Olfr1425 UTSW 19 12073960 missense probably benign 0.18
R7446:Olfr1425 UTSW 19 12073697 makesense probably null
R7505:Olfr1425 UTSW 19 12074605 missense possibly damaging 0.88
R9689:Olfr1425 UTSW 19 12074203 missense possibly damaging 0.90
Z1176:Olfr1425 UTSW 19 12073840 missense probably damaging 1.00
Z1176:Olfr1425 UTSW 19 12073910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCATGTAGGACACCAGTAAC -3'
(R):5'- TGGTGGACCTTCTCTCAGAC -3'

Sequencing Primer
(F):5'- CCATAGTGTGGTGAGCATTCC -3'
(R):5'- GTGGACCTTCTCTCAGACAGAAAG -3'
Posted On 2019-05-15