Mutagenetix > Incidental Mutations

Incidental Mutation 'R7109:Anapc1'

551379

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7109 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128674602 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 404 (V404A)

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]

AlphaFold

P53995

Predicted Effect

probably benign
Transcript: ENSMUST00000014499
AA Change: V404A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: V404A

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110333
AA Change: V404A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: V404A

Domain	Start	End	E-Value	Type
Pfam:Apc1	149	227	1.7e-22	PFAM
low complexity region	323	345	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	G	2: 151,473,753	K2Q	probably damaging	Het
Abtb2	T	C	2: 103,715,515	Y903H	probably benign	Het
Adamtsl3	C	T	7: 82,611,861	P29S		Het
Alcam	T	A	16: 52,276,829	T355S	probably damaging	Het
Bst2	A	G	8: 71,537,282	F49S	possibly damaging	Het
C1qtnf9	G	C	14: 60,779,570	W183S	probably benign	Het
Camsap3	A	G	8: 3,598,087	I132V	possibly damaging	Het
Cchcr1	T	A	17: 35,517,941		probably null	Het
Cenpk	A	G	13: 104,230,748	K31E	probably benign	Het
Cfap221	T	C	1: 119,925,571	K798E	possibly damaging	Het
Copb2	T	A	9: 98,581,280		probably null	Het
Dennd1a	T	A	2: 38,048,792	Y102F	probably damaging	Het
Eif2ak4	C	T	2: 118,405,051	P88S	probably damaging	Het
Epha6	C	A	16: 59,682,668	V959F	probably damaging	Het
Fam193a	C	A	5: 34,465,821	T1251K	possibly damaging	Het
Herc1	A	T	9: 66,481,889	Q3896L	probably benign	Het
Ikbip	C	A	10: 91,083,228	D34E	probably benign	Het
Insr	A	G	8: 3,258,481	V185A	probably benign	Het
Jakmip1	C	T	5: 37,174,765	Q930*	probably null	Het
Klc1	A	G	12: 111,776,865	I209V	probably benign	Het
Lrrk2	T	A	15: 91,764,782	L1660M	probably damaging	Het
Mbd3l1	G	T	9: 18,484,914	D112Y	possibly damaging	Het
Mrps2	T	A	2: 28,468,246	V16E	probably benign	Het
Ncoa1	G	A	12: 4,322,978	T141I	possibly damaging	Het
Ndst2	G	T	14: 20,729,843	R110S	probably damaging	Het
Nlrp2	A	G	7: 5,328,617	V260A	probably damaging	Het
Olfr1425	A	G	19: 12,074,212	I140T	probably benign	Het
Olfr491	A	G	7: 108,317,752	N286S	probably damaging	Het
Olfr575	A	T	7: 102,955,253	V116E	probably damaging	Het
Olfr828	A	T	9: 18,815,608	S229T	probably benign	Het
Pah	T	C	10: 87,570,286	V262A	probably damaging	Het
Pcnt	T	G	10: 76,369,904	E2538A	probably damaging	Het
Pdxk	T	A	10: 78,446,976	I162F	probably damaging	Het
Plod2	T	C	9: 92,573,597	F110L	probably damaging	Het
Pm20d2	A	T	4: 33,187,186	L154Q	probably damaging	Het
Podxl2	C	T	6: 88,843,584	V445I	possibly damaging	Het
Ppp1r3a	A	T	6: 14,719,236	W560R	probably benign	Het
Rasal3	A	G	17: 32,392,709	S815P	probably damaging	Het
Rdm1	A	G	11: 101,633,828	K196E	probably damaging	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Het
Scn1a	T	C	2: 66,350,942	D79G	possibly damaging	Het
Slc22a21	A	G	11: 53,979,503	Y119H	possibly damaging	Het
Stip1	C	T	19: 7,021,810	G467S	possibly damaging	Het
Synrg	C	A	11: 84,039,672	A1280E	possibly damaging	Het
Szt2	A	G	4: 118,375,479	C2396R	unknown	Het
Trappc3	A	G	4: 126,273,933	N95S	probably benign	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Ush2a	T	A	1: 188,381,484	D633E	probably benign	Het
Wasl	G	A	6: 24,633,187	P151S	probably benign	Het
Wwp2	A	G	8: 107,483,356	N122S	probably benign	Het
Zfp51	A	G	17: 21,463,569	R149G	possibly damaging	Het
Zfp764	A	G	7: 127,404,715	S415P	possibly damaging	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128645130	splice site	probably benign
IGL00704:Anapc1	APN	2	128663984	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128629729	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128633408	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128653170	missense	probably benign
IGL02089:Anapc1	APN	2	128663933	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128659852	missense	probably benign
IGL02570:Anapc1	APN	2	128645200	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128623931	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128659785	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128627197	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128627113	splice site	probably benign
IGL03327:Anapc1	APN	2	128623934	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128678218	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128623966	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128634711	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128641340	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128669043	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128632655	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128619332	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128617731	missense	probably benign
R1175:Anapc1	UTSW	2	128680188	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128617697	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128617556	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128624899	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128617716	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128628532	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128658246	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128676208	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128675890	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128659788	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128633415	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128669688	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128648458	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128642548	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128680137	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128642682	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128642519	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128627229	intron	probably benign
R4359:Anapc1	UTSW	2	128623556	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128676249	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128627195	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128664005	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128686060	splice site	probably benign
R4824:Anapc1	UTSW	2	128628690	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128684594	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128607175	unclassified	probably benign
R5063:Anapc1	UTSW	2	128629549	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128659917	missense	probably benign
R5271:Anapc1	UTSW	2	128685985	nonsense	probably null
R5363:Anapc1	UTSW	2	128650194	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128675701	nonsense	probably null
R5473:Anapc1	UTSW	2	128607195	unclassified	probably benign
R5559:Anapc1	UTSW	2	128680434	nonsense	probably null
R5631:Anapc1	UTSW	2	128657217	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128624916	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128607037	unclassified	probably benign
R6226:Anapc1	UTSW	2	128650372	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128672135	nonsense	probably null
R6561:Anapc1	UTSW	2	128663999	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128684534	nonsense	probably null
R6799:Anapc1	UTSW	2	128659737	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128659768	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128669900	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128648681	splice site	probably null
R7041:Anapc1	UTSW	2	128628656	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128615430	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128678274	missense	probably damaging	1.00
R7123:Anapc1	UTSW	2	128613010	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128674684	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128641537	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128684608	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128669908	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128674593	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128648488	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128632627	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128619917	nonsense	probably null
R8402:Anapc1	UTSW	2	128630228	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128675837	missense	probably benign
R8425:Anapc1	UTSW	2	128669868	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128658344	splice site	probably null
R8553:Anapc1	UTSW	2	128619913	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128685828	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128641453	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128641449	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128622413	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128664032	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128641402	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128634708	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128622506	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128623502	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128622500	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128617722	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128634678	missense	probably benign
R9436:Anapc1	UTSW	2	128676125	missense	probably benign
X0066:Anapc1	UTSW	2	128674701	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TCTCCGGCCCTGAAGATTACTATC -3'
(R):5'- AAGCTGCTCATCGTGACACC -3'

Sequencing Primer
(F):5'- GTGCTAGTACCATACCTAAAATTCAC -3'
(R):5'- GTGACACCCTCTCCCTGG -3'

Posted On

2019-05-15