Incidental Mutation 'PIT4243001:Spag16'
ID554443
Institutional Source Beutler Lab
Gene Symbol Spag16
Ensembl Gene ENSMUSG00000053153
Gene Namesperm associated antigen 16
Synonyms4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #PIT4243001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location69826970-70725132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69853381 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 107 (L107P)
Ref Sequence ENSEMBL: ENSMUSP00000069821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065425] [ENSMUST00000113940]
Predicted Effect probably damaging
Transcript: ENSMUST00000065425
AA Change: L107P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: L107P

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
WD40 349 388 7.8e-2 SMART
WD40 391 430 6.23e-10 SMART
WD40 433 472 1.34e-9 SMART
WD40 475 514 1.92e-10 SMART
WD40 517 556 2.38e-6 SMART
WD40 559 598 1.42e2 SMART
WD40 600 639 4.83e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113940
AA Change: L107P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109573
Gene: ENSMUSG00000053153
AA Change: L107P

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
low complexity region 342 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 85.2%
  • 20x: 74.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,140 E252V possibly damaging Het
Abhd13 T C 8: 9,987,967 F188S possibly damaging Het
Abtb1 A G 6: 88,838,726 V225A probably benign Het
Accs A G 2: 93,841,334 M237T probably benign Het
Adcy9 A G 16: 4,418,407 I380T probably damaging Het
Add3 T C 19: 53,236,690 S414P probably benign Het
Ak3 C T 19: 29,037,871 probably null Het
Atg14 T C 14: 47,554,574 E132G possibly damaging Het
Bcl2l11 A G 2: 128,147,106 E135G probably benign Het
Brwd1 G A 16: 96,002,671 Q2100* probably null Het
Card11 A C 5: 140,908,604 V90G possibly damaging Het
Celsr3 T C 9: 108,832,308 V1451A probably benign Het
Clip4 T C 17: 71,806,728 I291T probably damaging Het
Clk1 C T 1: 58,419,677 D179N probably damaging Het
Cyp11b2 A G 15: 74,851,453 L454P probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Ep400 A G 5: 110,735,580 S663P unknown Het
Erich6 G A 3: 58,629,879 T238I possibly damaging Het
Herc1 T A 9: 66,372,207 H132Q probably benign Het
Hk2 A G 6: 82,730,877 C704R probably damaging Het
Ift74 A T 4: 94,686,904 R531W possibly damaging Het
Ism2 T C 12: 87,287,058 E71G probably benign Het
Lipe A C 7: 25,395,546 S22A probably benign Het
Myl10 A G 5: 136,694,293 D32G probably benign Het
Nomo1 A G 7: 46,044,281 H179R probably damaging Het
Olfr133 T C 17: 38,149,503 F305S probably benign Het
Olfr1378 T C 11: 50,969,552 F178S probably damaging Het
Pdpn T A 4: 143,270,538 T129S probably damaging Het
Pold1 C T 7: 44,542,158 V135I possibly damaging Het
Rasgrp3 T A 17: 75,500,139 N199K probably damaging Het
Skil T C 3: 31,113,565 S449P probably damaging Het
Tbccd1 A G 16: 22,822,337 M430T probably damaging Het
Tnfaip3 G A 10: 19,011,574 L68F probably damaging Het
Trrap G A 5: 144,796,971 R878H probably benign Het
Vasn T C 16: 4,649,616 S476P probably damaging Het
Vmn2r110 T A 17: 20,582,117 M499L probably benign Het
Wwp1 T C 4: 19,638,631 T571A probably damaging Het
Zfp608 C A 18: 54,898,024 G948V probably damaging Het
Zswim5 A G 4: 116,984,778 I852V probably benign Het
Other mutations in Spag16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Spag16 APN 1 70299650 missense probably damaging 1.00
IGL01129:Spag16 APN 1 69896522 missense probably benign 0.01
IGL02117:Spag16 APN 1 69870320 missense probably damaging 1.00
IGL02245:Spag16 APN 1 69858502 missense probably benign
IGL02492:Spag16 APN 1 69887529 missense probably benign
IGL02851:Spag16 APN 1 70264908 missense possibly damaging 0.76
IGL03271:Spag16 APN 1 69853352 missense probably benign 0.00
IGL03274:Spag16 APN 1 69844381 splice site probably benign
R0084:Spag16 UTSW 1 69996839 missense probably benign 0.02
R0513:Spag16 UTSW 1 70493768 splice site probably benign
R0653:Spag16 UTSW 1 69870345 missense probably damaging 1.00
R1165:Spag16 UTSW 1 69996877 missense probably benign 0.04
R1178:Spag16 UTSW 1 69923658 splice site probably benign
R1180:Spag16 UTSW 1 69923658 splice site probably benign
R1404:Spag16 UTSW 1 69895280 splice site probably benign
R1547:Spag16 UTSW 1 69873243 missense possibly damaging 0.51
R1689:Spag16 UTSW 1 70461118 missense probably benign 0.01
R1699:Spag16 UTSW 1 69996856 missense probably benign 0.05
R1714:Spag16 UTSW 1 69843005 missense probably damaging 0.97
R1724:Spag16 UTSW 1 70493782 missense probably damaging 1.00
R1873:Spag16 UTSW 1 69896585 splice site probably benign
R2196:Spag16 UTSW 1 69858522 missense possibly damaging 0.92
R2207:Spag16 UTSW 1 70724884 missense probably benign 0.00
R4058:Spag16 UTSW 1 69853328 missense probably damaging 0.96
R4276:Spag16 UTSW 1 69873481 intron probably benign
R4497:Spag16 UTSW 1 70493830 missense probably damaging 1.00
R4560:Spag16 UTSW 1 69844296 missense probably benign 0.05
R4648:Spag16 UTSW 1 69827035 missense probably null 0.99
R4972:Spag16 UTSW 1 70724928 missense probably damaging 1.00
R5027:Spag16 UTSW 1 69923804 intron probably benign
R5032:Spag16 UTSW 1 69853352 missense probably benign 0.00
R5174:Spag16 UTSW 1 70493796 missense probably damaging 1.00
R5276:Spag16 UTSW 1 69896583 critical splice donor site probably null
R5537:Spag16 UTSW 1 69827016 missense probably benign
R5706:Spag16 UTSW 1 69870289 missense probably benign 0.01
R5834:Spag16 UTSW 1 69923714 missense probably benign 0.00
R6131:Spag16 UTSW 1 70725083 utr 3 prime probably null
R6246:Spag16 UTSW 1 69923821 missense probably benign 0.45
R7164:Spag16 UTSW 1 70724866 missense possibly damaging 0.88
R7261:Spag16 UTSW 1 70299621 missense possibly damaging 0.56
R7358:Spag16 UTSW 1 69844367 missense probably benign 0.00
R7431:Spag16 UTSW 1 69923872 missense unknown
R7508:Spag16 UTSW 1 69887520 missense possibly damaging 0.93
R7566:Spag16 UTSW 1 69870328 missense probably damaging 1.00
R7570:Spag16 UTSW 1 69996841 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTGTGATTAAAATAGACCCTGG -3'
(R):5'- CTGGGAGAATCGTGCTGTAG -3'

Sequencing Primer
(F):5'- GACCCTGGTAAATAATACTTGA -3'
(R):5'- TGGCATGCATTCAACAGTCCATG -3'
Posted On2019-06-07