Incidental Mutation 'R1714:Spag16'
ID190827
Institutional Source Beutler Lab
Gene Symbol Spag16
Ensembl Gene ENSMUSG00000053153
Gene Namesperm associated antigen 16
Synonyms4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik
MMRRC Submission 039747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R1714 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location69826970-70725132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69843005 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 52 (E52G)
Ref Sequence ENSEMBL: ENSMUSP00000109573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065425] [ENSMUST00000113940]
Predicted Effect probably damaging
Transcript: ENSMUST00000065425
AA Change: E52G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: E52G

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
WD40 349 388 7.8e-2 SMART
WD40 391 430 6.23e-10 SMART
WD40 433 472 1.34e-9 SMART
WD40 475 514 1.92e-10 SMART
WD40 517 556 2.38e-6 SMART
WD40 559 598 1.42e2 SMART
WD40 600 639 4.83e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113940
AA Change: E52G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109573
Gene: ENSMUSG00000053153
AA Change: E52G

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
low complexity region 342 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161131
SMART Domains Protein: ENSMUSP00000124372
Gene: ENSMUSG00000053153

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190833
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,316,360 T892I possibly damaging Het
Abcb11 A C 2: 69,306,581 F179V probably damaging Het
Adgrg6 G T 10: 14,439,770 Q597K possibly damaging Het
Ankmy1 G T 1: 92,885,194 Y464* probably null Het
Apba1 G A 19: 23,944,952 E795K possibly damaging Het
Aqp12 T A 1: 93,006,959 V186D possibly damaging Het
Brd8 A T 18: 34,609,833 S253R probably damaging Het
Cdc42se2 A T 11: 54,740,286 S2R possibly damaging Het
Chd9 A C 8: 91,034,225 probably benign Het
Clk4 C T 11: 51,280,418 H219Y probably damaging Het
Cngb1 A G 8: 95,257,931 Y417H probably damaging Het
Cr2 A T 1: 195,151,686 F932I possibly damaging Het
Cxxc1 C A 18: 74,219,863 R415S probably damaging Het
Dclk2 G A 3: 86,906,093 A182V probably benign Het
Ddx11 T G 17: 66,148,759 W718G probably damaging Het
Dmd A C X: 83,964,750 T2069P probably benign Het
Dnaic1 T C 4: 41,632,164 F533L probably benign Het
Dnajc5b A T 3: 19,579,101 R163* probably null Het
Dynll2 T A 11: 87,984,012 probably null Het
Ercc5 A G 1: 44,167,339 T471A probably benign Het
Fan1 T C 7: 64,366,687 D563G probably benign Het
Fbxo34 A G 14: 47,529,201 Y6C probably damaging Het
Fcrl5 T A 3: 87,446,406 S353T probably damaging Het
Gabrb3 A T 7: 57,765,428 Y82F probably damaging Het
Gm20939 C A 17: 94,875,806 P157T probably damaging Het
Haus3 A T 5: 34,163,697 H468Q probably benign Het
Hist1h2ba T C 13: 23,933,952 T69A probably benign Het
Il20ra T C 10: 19,755,828 V259A probably damaging Het
Isg15 A T 4: 156,199,957 V38E probably damaging Het
Kcnq3 A G 15: 66,000,063 S586P probably benign Het
Kl A T 5: 150,953,333 Y206F probably benign Het
Klk1b24 C A 7: 44,191,515 D122E probably damaging Het
Kmt2d A C 15: 98,862,950 S840A unknown Het
Krt34 A G 11: 100,040,127 S150P possibly damaging Het
Lamc3 A G 2: 31,940,757 K1502R probably benign Het
Letm1 G T 5: 33,760,884 R306S possibly damaging Het
Lnx1 C T 5: 74,607,737 G397S probably null Het
Lrrc8c A G 5: 105,607,291 T311A possibly damaging Het
Mpeg1 A T 19: 12,462,834 D552V probably damaging Het
Myh11 C T 16: 14,236,368 probably null Het
Ndufa9 T C 6: 126,822,191 probably null Het
Olfr1289 A T 2: 111,483,663 I78F probably damaging Het
Olfr1507 A C 14: 52,490,414 probably null Het
Olfr281 G A 15: 98,456,733 C141Y probably damaging Het
Polr3d A C 14: 70,441,315 M117R possibly damaging Het
Ppp5c T C 7: 17,008,703 I237V probably benign Het
Prrc2c G A 1: 162,677,376 T2632M probably damaging Het
Ptprg C A 14: 12,213,697 Q1022K probably damaging Het
Pus10 T A 11: 23,725,542 H471Q probably damaging Het
Ralgapa1 A G 12: 55,642,389 V1928A probably damaging Het
Rbpms2 CACT CACTACT 9: 65,651,665 probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfpl4 T G 7: 5,110,358 T269P probably benign Het
Rgs10 A G 7: 128,403,222 V72A probably damaging Het
Rsph1 T C 17: 31,255,216 N289S probably benign Het
Sbk2 T C 7: 4,963,122 D21G probably benign Het
Shbg A T 11: 69,617,157 D127E possibly damaging Het
Ssh2 G A 11: 77,454,024 G945D possibly damaging Het
Sstr3 A T 15: 78,540,273 D91E probably damaging Het
Syne2 C A 12: 76,054,939 A669E probably benign Het
Traf3 A G 12: 111,242,473 I109V probably benign Het
Ube2j1 A G 4: 33,049,886 T295A probably damaging Het
Usp46 A G 5: 74,003,167 V276A probably benign Het
Vmn1r200 T C 13: 22,395,470 S139P possibly damaging Het
Ydjc G A 16: 17,147,799 V143M probably damaging Het
Zfp169 T C 13: 48,498,854 E29G probably benign Het
Zfp292 A G 4: 34,808,935 S1370P probably damaging Het
Zfp763 C T 17: 33,019,617 D185N probably damaging Het
Zfp827 A T 8: 79,060,573 N123Y probably damaging Het
Zfp979 A T 4: 147,613,985 I89N probably damaging Het
Zfr2 T C 10: 81,244,749 L419P probably damaging Het
Other mutations in Spag16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Spag16 APN 1 70299650 missense probably damaging 1.00
IGL01129:Spag16 APN 1 69896522 missense probably benign 0.01
IGL02117:Spag16 APN 1 69870320 missense probably damaging 1.00
IGL02245:Spag16 APN 1 69858502 missense probably benign
IGL02492:Spag16 APN 1 69887529 missense probably benign
IGL02851:Spag16 APN 1 70264908 missense possibly damaging 0.76
IGL03271:Spag16 APN 1 69853352 missense probably benign 0.00
IGL03274:Spag16 APN 1 69844381 splice site probably benign
PIT4243001:Spag16 UTSW 1 69853381 missense probably damaging 1.00
R0084:Spag16 UTSW 1 69996839 missense probably benign 0.02
R0513:Spag16 UTSW 1 70493768 splice site probably benign
R0653:Spag16 UTSW 1 69870345 missense probably damaging 1.00
R1165:Spag16 UTSW 1 69996877 missense probably benign 0.04
R1178:Spag16 UTSW 1 69923658 splice site probably benign
R1180:Spag16 UTSW 1 69923658 splice site probably benign
R1404:Spag16 UTSW 1 69895280 splice site probably benign
R1547:Spag16 UTSW 1 69873243 missense possibly damaging 0.51
R1689:Spag16 UTSW 1 70461118 missense probably benign 0.01
R1699:Spag16 UTSW 1 69996856 missense probably benign 0.05
R1724:Spag16 UTSW 1 70493782 missense probably damaging 1.00
R1873:Spag16 UTSW 1 69896585 splice site probably benign
R2196:Spag16 UTSW 1 69858522 missense possibly damaging 0.92
R2207:Spag16 UTSW 1 70724884 missense probably benign 0.00
R4058:Spag16 UTSW 1 69853328 missense probably damaging 0.96
R4276:Spag16 UTSW 1 69873481 intron probably benign
R4497:Spag16 UTSW 1 70493830 missense probably damaging 1.00
R4560:Spag16 UTSW 1 69844296 missense probably benign 0.05
R4648:Spag16 UTSW 1 69827035 missense probably null 0.99
R4972:Spag16 UTSW 1 70724928 missense probably damaging 1.00
R5027:Spag16 UTSW 1 69923804 intron probably benign
R5032:Spag16 UTSW 1 69853352 missense probably benign 0.00
R5174:Spag16 UTSW 1 70493796 missense probably damaging 1.00
R5276:Spag16 UTSW 1 69896583 critical splice donor site probably null
R5537:Spag16 UTSW 1 69827016 missense probably benign
R5706:Spag16 UTSW 1 69870289 missense probably benign 0.01
R5834:Spag16 UTSW 1 69923714 missense probably benign 0.00
R6131:Spag16 UTSW 1 70725083 utr 3 prime probably null
R6246:Spag16 UTSW 1 69923821 missense probably benign 0.45
R7164:Spag16 UTSW 1 70724866 missense possibly damaging 0.88
R7261:Spag16 UTSW 1 70299621 missense possibly damaging 0.56
R7298:Spag16 UTSW 1 69919426 intron probably null
R7358:Spag16 UTSW 1 69844367 missense probably benign 0.00
R7431:Spag16 UTSW 1 69923872 missense unknown
R7508:Spag16 UTSW 1 69887520 missense possibly damaging 0.93
R7566:Spag16 UTSW 1 69870328 missense probably damaging 1.00
R7570:Spag16 UTSW 1 69996841 missense probably benign 0.00
R7598:Spag16 UTSW 1 69870308 missense probably damaging 1.00
R7942:Spag16 UTSW 1 69827088 missense probably benign 0.11
R8047:Spag16 UTSW 1 69842996 missense probably damaging 1.00
R8132:Spag16 UTSW 1 70381302 missense probably damaging 1.00
R8329:Spag16 UTSW 1 69895248 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCTTTGCACCTGTTATGAGAGGG -3'
(R):5'- CATAAGCAGTGATGCTGAGGGAACC -3'

Sequencing Primer
(F):5'- ACTGATGCCCTTCTAGCCAG -3'
(R):5'- GCAGATGTCCTAGACAGTGC -3'
Posted On2014-05-14