Incidental Mutation 'R1547:Spag16'
Institutional Source Beutler Lab
Gene Symbol Spag16
Ensembl Gene ENSMUSG00000053153
Gene Namesperm associated antigen 16
Synonyms4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik
MMRRC Submission 039586-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R1547 (G1)
Quality Score225
Status Not validated
Chromosomal Location69826970-70725132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69873243 bp
Amino Acid Change Valine to Phenylalanine at position 246 (V246F)
Ref Sequence ENSEMBL: ENSMUSP00000109573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065425] [ENSMUST00000113940]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065425
AA Change: V246F

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: V246F

low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
WD40 349 388 7.8e-2 SMART
WD40 391 430 6.23e-10 SMART
WD40 433 472 1.34e-9 SMART
WD40 475 514 1.92e-10 SMART
WD40 517 556 2.38e-6 SMART
WD40 559 598 1.42e2 SMART
WD40 600 639 4.83e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113940
AA Change: V246F

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109573
Gene: ENSMUSG00000053153
AA Change: V246F

low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
low complexity region 342 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161131
SMART Domains Protein: ENSMUSP00000124372
Gene: ENSMUSG00000053153

low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190833
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,690 F52L probably damaging Het
3632451O06Rik A T 14: 49,773,496 D251E probably benign Het
Adam17 A C 12: 21,353,957 V96G probably damaging Het
Adam5 G T 8: 24,810,713 Q267K probably benign Het
Adamts6 A G 13: 104,444,875 T833A probably benign Het
Ago4 C T 4: 126,511,413 E456K probably benign Het
Anapc1 T C 2: 128,617,556 Q1861R probably benign Het
Apob A T 12: 8,003,368 D1270V probably benign Het
Arhgef11 T A 3: 87,695,402 I196N possibly damaging Het
Capzb G A 4: 139,262,098 probably null Het
Ccdc183 T A 2: 25,609,350 T466S probably benign Het
Cd101 T C 3: 101,018,951 T151A possibly damaging Het
Cdc42bpa A T 1: 180,074,644 I489F probably damaging Het
Cetn4 T C 3: 37,309,451 K52R possibly damaging Het
Dock6 C T 9: 21,814,588 E1440K probably damaging Het
Edem2 A G 2: 155,722,516 F94L probably damaging Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Fam172a T C 13: 77,825,390 probably null Het
Fam189a2 T C 19: 23,979,701 D315G probably damaging Het
Fat2 G A 11: 55,252,255 P4256L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Ikbkap C A 4: 56,792,090 R226L probably damaging Het
Ikbkap C T 4: 56,798,810 V51M probably damaging Het
Kif19a A G 11: 114,786,572 E594G probably benign Het
Kifap3 A G 1: 163,794,086 D101G probably benign Het
Klhl6 T C 16: 19,966,082 D102G probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lamb2 A G 9: 108,482,625 H388R probably benign Het
Lmna T C 3: 88,482,351 S656G probably benign Het
Map3k12 T A 15: 102,503,852 I285F probably damaging Het
Map3k7 A G 4: 31,991,796 I345V probably benign Het
Mcph1 A G 8: 18,622,686 R111G possibly damaging Het
Mfsd6l T A 11: 68,556,608 V95D probably damaging Het
Mogs T A 6: 83,116,025 M118K possibly damaging Het
Npy5r T C 8: 66,681,034 E369G possibly damaging Het
Olfr218 T A 1: 173,203,672 Y105* probably null Het
Olfr331 A G 11: 58,501,825 S244P probably damaging Het
Olfr875 A C 9: 37,772,664 T2P probably benign Het
Pde7b C A 10: 20,434,594 L207F probably damaging Het
Pigo A G 4: 43,020,689 V751A probably benign Het
Polr2a T C 11: 69,734,555 Y1923C probably benign Het
Prokr2 T C 2: 132,373,602 Y152C probably damaging Het
Rab40c A G 17: 25,883,750 S223P probably damaging Het
Recql4 A C 15: 76,706,311 C658G probably damaging Het
Sgca T C 11: 94,969,433 T46A probably damaging Het
Slc39a4 G T 15: 76,614,147 C363* probably null Het
Snap25 A T 2: 136,777,469 I181F possibly damaging Het
Snx32 T A 19: 5,497,311 Q256L possibly damaging Het
Soat1 A G 1: 156,439,761 V284A probably damaging Het
Sox6 G A 7: 115,701,722 T170M possibly damaging Het
St6galnac6 T C 2: 32,614,965 V141A possibly damaging Het
Sult2a7 T A 7: 14,477,122 probably null Het
Syngr3 A T 17: 24,687,724 V39E probably damaging Het
Tango6 A G 8: 106,781,786 T917A probably damaging Het
Tas1r1 A G 4: 152,028,419 S726P probably damaging Het
Zeb1 C T 18: 5,767,450 R654C possibly damaging Het
Other mutations in Spag16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Spag16 APN 1 70299650 missense probably damaging 1.00
IGL01129:Spag16 APN 1 69896522 missense probably benign 0.01
IGL02117:Spag16 APN 1 69870320 missense probably damaging 1.00
IGL02245:Spag16 APN 1 69858502 missense probably benign
IGL02492:Spag16 APN 1 69887529 missense probably benign
IGL02851:Spag16 APN 1 70264908 missense possibly damaging 0.76
IGL03271:Spag16 APN 1 69853352 missense probably benign 0.00
IGL03274:Spag16 APN 1 69844381 splice site probably benign
PIT4243001:Spag16 UTSW 1 69853381 missense probably damaging 1.00
R0084:Spag16 UTSW 1 69996839 missense probably benign 0.02
R0513:Spag16 UTSW 1 70493768 splice site probably benign
R0653:Spag16 UTSW 1 69870345 missense probably damaging 1.00
R1165:Spag16 UTSW 1 69996877 missense probably benign 0.04
R1178:Spag16 UTSW 1 69923658 splice site probably benign
R1180:Spag16 UTSW 1 69923658 splice site probably benign
R1404:Spag16 UTSW 1 69895280 splice site probably benign
R1689:Spag16 UTSW 1 70461118 missense probably benign 0.01
R1699:Spag16 UTSW 1 69996856 missense probably benign 0.05
R1714:Spag16 UTSW 1 69843005 missense probably damaging 0.97
R1724:Spag16 UTSW 1 70493782 missense probably damaging 1.00
R1873:Spag16 UTSW 1 69896585 splice site probably benign
R2196:Spag16 UTSW 1 69858522 missense possibly damaging 0.92
R2207:Spag16 UTSW 1 70724884 missense probably benign 0.00
R4058:Spag16 UTSW 1 69853328 missense probably damaging 0.96
R4276:Spag16 UTSW 1 69873481 intron probably benign
R4497:Spag16 UTSW 1 70493830 missense probably damaging 1.00
R4560:Spag16 UTSW 1 69844296 missense probably benign 0.05
R4648:Spag16 UTSW 1 69827035 missense probably null 0.99
R4972:Spag16 UTSW 1 70724928 missense probably damaging 1.00
R5027:Spag16 UTSW 1 69923804 intron probably benign
R5032:Spag16 UTSW 1 69853352 missense probably benign 0.00
R5174:Spag16 UTSW 1 70493796 missense probably damaging 1.00
R5276:Spag16 UTSW 1 69896583 critical splice donor site probably null
R5537:Spag16 UTSW 1 69827016 missense probably benign
R5706:Spag16 UTSW 1 69870289 missense probably benign 0.01
R5834:Spag16 UTSW 1 69923714 missense probably benign 0.00
R6131:Spag16 UTSW 1 70725083 splice site probably null
R6246:Spag16 UTSW 1 69923821 missense probably benign 0.45
R7164:Spag16 UTSW 1 70724866 missense possibly damaging 0.88
R7261:Spag16 UTSW 1 70299621 missense possibly damaging 0.56
R7298:Spag16 UTSW 1 69919426 splice site probably null
R7358:Spag16 UTSW 1 69844367 missense probably benign 0.00
R7431:Spag16 UTSW 1 69923872 missense unknown
R7508:Spag16 UTSW 1 69887520 missense possibly damaging 0.93
R7566:Spag16 UTSW 1 69870328 missense probably damaging 1.00
R7570:Spag16 UTSW 1 69996841 missense probably benign 0.00
R7598:Spag16 UTSW 1 69870308 missense probably damaging 1.00
R7942:Spag16 UTSW 1 69827088 missense probably benign 0.11
R8047:Spag16 UTSW 1 69842996 missense probably damaging 1.00
R8132:Spag16 UTSW 1 70381302 missense probably damaging 1.00
R8329:Spag16 UTSW 1 69895248 missense probably benign 0.00
Predicted Primers PCR Primer
(R):5'- TGAATGCTAAgggttggagcaacag -3'

Sequencing Primer
(R):5'- gcttcagtccaatgagagacc -3'
Posted On2014-04-13