Incidental Mutation 'PIT4696001:Cat'
ID556771
Institutional Source Beutler Lab
Gene Symbol Cat
Ensembl Gene ENSMUSG00000027187
Gene Namecatalase
SynonymsCas1, Cas-1, Cs-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4696001 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location103453849-103485160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103471812 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 180 (D180G)
Ref Sequence ENSEMBL: ENSMUSP00000028610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028610] [ENSMUST00000111168]
Predicted Effect probably damaging
Transcript: ENSMUST00000028610
AA Change: D180G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028610
Gene: ENSMUSG00000027187
AA Change: D180G

DomainStartEndE-ValueType
Catalase 28 413 4.7e-285 SMART
Pfam:Catalase-rel 434 497 5.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111168
SMART Domains Protein: ENSMUSP00000106798
Gene: ENSMUSG00000027187

DomainStartEndE-ValueType
Catalase 28 176 2.33e-3 SMART
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.0%
  • 10x: 86.2%
  • 20x: 75.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a generally normal phenotype although subtle abnormalities do occur in mitochondrial respiration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,986 probably null Het
Adam20 T A 8: 40,794,948 Y32N probably benign Het
Adm T C 7: 110,628,289 V4A probably benign Het
Anpep G A 7: 79,839,464 T320I possibly damaging Het
Atp8b1 T C 18: 64,539,270 S1008G possibly damaging Het
B9d1 T A 11: 61,505,243 M12K possibly damaging Het
Cad T C 5: 31,072,094 L1435P probably damaging Het
Cntln C T 4: 84,974,000 T374M probably damaging Het
Cyp2a5 G A 7: 26,840,979 R339Q probably benign Het
Defa22 T C 8: 21,162,336 L6P probably damaging Het
Dr1 T A 5: 108,269,738 I50K probably damaging Het
Eln C T 5: 134,737,178 G57E unknown Het
Fat4 T C 3: 38,889,004 I682T probably benign Het
Fat4 C A 3: 38,982,357 A3386E probably damaging Het
Fcgr3 T A 1: 171,057,750 Y102F probably damaging Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Herc1 T A 9: 66,479,009 V3748D probably damaging Het
Ino80d A G 1: 63,085,986 S106P probably benign Het
Kcns3 C T 12: 11,092,748 probably benign Het
Kndc1 T A 7: 139,932,917 L1527Q probably damaging Het
Lepr T G 4: 101,779,983 S690A probably benign Het
Lrfn5 T C 12: 61,843,557 F544S probably damaging Het
Mapkap1 C A 2: 34,619,849 H450Q probably damaging Het
Mdm1 A G 10: 118,158,540 T485A probably benign Het
Megf10 T C 18: 57,277,688 C690R probably damaging Het
Myo7a A G 7: 98,063,599 M1723T probably benign Het
Nrip3 A T 7: 109,765,507 C137* probably null Het
Olfr153 T A 2: 87,532,780 I249N probably damaging Het
Pde4a T A 9: 21,211,001 M731K probably benign Het
Pebp1 A G 5: 117,283,462 L117P probably damaging Het
Phc2 T C 4: 128,705,202 Y51H probably damaging Het
Ppp2r5b A G 19: 6,234,683 F50S probably benign Het
Prpf4b A G 13: 34,899,842 S865G probably benign Het
Ptpn5 C T 7: 47,088,606 V243M probably benign Het
Rora T C 9: 69,364,559 L273P possibly damaging Het
Rtp4 T A 16: 23,613,454 S245R probably benign Het
Scgb2b20 C T 7: 33,364,560 G95D probably benign Het
Sec24b A G 3: 129,994,391 V820A probably benign Het
Sim2 A G 16: 94,094,309 D62G possibly damaging Het
Slc17a4 A T 13: 23,900,514 V429D probably benign Het
Sp2 T C 11: 96,961,973 T42A probably damaging Het
Spata3 G A 1: 86,024,447 R141Q unknown Het
Sptbn2 A T 19: 4,745,577 E1658D probably benign Het
Tcaf1 T C 6: 42,678,539 H501R probably benign Het
Tec G A 5: 72,773,835 T262M possibly damaging Het
Timm9 A T 12: 71,125,531 N22K possibly damaging Het
Tln1 C T 4: 43,542,701 probably null Het
Tmbim4 A G 10: 120,217,624 I109M probably benign Het
Tmc7 T C 7: 118,564,343 K110E probably benign Het
Tmem107 C T 11: 69,072,573 P136L probably benign Het
Ttc21b T C 2: 66,231,219 probably null Het
Ubd A C 17: 37,195,444 T74P probably damaging Het
Vps11 A G 9: 44,358,189 V255A possibly damaging Het
Vsnl1 T C 12: 11,326,447 T146A probably benign Het
Wdr38 G T 2: 38,999,972 probably null Het
Yes1 T A 5: 32,684,625 S498T possibly damaging Het
Zc3h13 G A 14: 75,331,883 R1390H probably damaging Het
Zscan4b A G 7: 10,902,022 V126A possibly damaging Het
Other mutations in Cat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02989:Cat APN 2 103472973 missense probably damaging 1.00
R1968:Cat UTSW 2 103484989 missense probably benign 0.01
R2103:Cat UTSW 2 103463315 missense probably damaging 1.00
R2655:Cat UTSW 2 103471846 missense probably damaging 1.00
R3037:Cat UTSW 2 103467777 missense probably benign 0.07
R5287:Cat UTSW 2 103474360 missense probably damaging 1.00
R5527:Cat UTSW 2 103472973 missense probably damaging 1.00
R5694:Cat UTSW 2 103472994 missense probably damaging 1.00
R6089:Cat UTSW 2 103472951 missense probably null 0.48
R6177:Cat UTSW 2 103473075 missense probably damaging 1.00
R6281:Cat UTSW 2 103471769 missense probably damaging 1.00
R6294:Cat UTSW 2 103460295 missense probably benign
R7058:Cat UTSW 2 103474353 missense probably benign 0.31
R7274:Cat UTSW 2 103476890 missense probably benign 0.07
R7347:Cat UTSW 2 103463298 missense probably benign
R7654:Cat UTSW 2 103460364 missense probably damaging 1.00
R7762:Cat UTSW 2 103456858 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAACCATCTAAGCATCATGTTAGATG -3'
(R):5'- GCTCTGAGTGCATTTGACAC -3'

Sequencing Primer
(F):5'- GCATCATGTTAGATGTAAACTCTTTG -3'
(R):5'- CCAAAGATGGTTGTATGTACTGAAC -3'
Posted On2019-06-07