Incidental Mutation 'PIT4696001:Slc17a4'
ID556811
Institutional Source Beutler Lab
Gene Symbol Slc17a4
Ensembl Gene ENSMUSG00000021336
Gene Namesolute carrier family 17 (sodium phosphate), member 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #PIT4696001 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23895890-23915009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23900514 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 429 (V429D)
Ref Sequence ENSEMBL: ENSMUSP00000106037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006785] [ENSMUST00000021769] [ENSMUST00000110407] [ENSMUST00000110413] [ENSMUST00000225797]
Predicted Effect probably benign
Transcript: ENSMUST00000006785
SMART Domains Protein: ENSMUSP00000006785
Gene: ENSMUSG00000021335

DomainStartEndE-ValueType
Pfam:MFS_1 24 412 2.7e-48 PFAM
transmembrane domain 430 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021769
AA Change: V429D

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021769
Gene: ENSMUSG00000021336
AA Change: V429D

DomainStartEndE-ValueType
Pfam:MFS_1 40 373 1.4e-48 PFAM
Pfam:MFS_1 361 492 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110407
AA Change: V429D

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000106037
Gene: ENSMUSG00000021336
AA Change: V429D

DomainStartEndE-ValueType
Pfam:MFS_1 40 371 1.7e-47 PFAM
Pfam:MFS_1 359 490 3.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110413
SMART Domains Protein: ENSMUSP00000106043
Gene: ENSMUSG00000021335

DomainStartEndE-ValueType
Pfam:MFS_1 24 412 3.1e-48 PFAM
transmembrane domain 430 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225797
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.0%
  • 10x: 86.2%
  • 20x: 75.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphate homeostasis is maintained by regulating intake, intestinal absorption, bone deposition and resorption, and renal excretion of phosphate. The central molecule in the control of phosphate excretion from the kidney is the sodium/phosphate cotransporter NPT1 (SLC17A1; MIM 182308), which is located in the renal proximal tubule. NPT1 uses the transmembrane electrochemical potential gradient of sodium to transport phosphate across the cell membrane. SLC17A4 is a similar sodium/phosphate cotransporter in the intestinal mucosa that plays an important role in the absorption of phosphate from the intestine (summary by Shibui et al., 1999 [PubMed 10319585]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,986 probably null Het
Adam20 T A 8: 40,794,948 Y32N probably benign Het
Adm T C 7: 110,628,289 V4A probably benign Het
Anpep G A 7: 79,839,464 T320I possibly damaging Het
Atp8b1 T C 18: 64,539,270 S1008G possibly damaging Het
B9d1 T A 11: 61,505,243 M12K possibly damaging Het
Cad T C 5: 31,072,094 L1435P probably damaging Het
Cat T C 2: 103,471,812 D180G probably damaging Het
Cntln C T 4: 84,974,000 T374M probably damaging Het
Cyp2a5 G A 7: 26,840,979 R339Q probably benign Het
Defa22 T C 8: 21,162,336 L6P probably damaging Het
Dr1 T A 5: 108,269,738 I50K probably damaging Het
Eln C T 5: 134,737,178 G57E unknown Het
Fat4 T C 3: 38,889,004 I682T probably benign Het
Fat4 C A 3: 38,982,357 A3386E probably damaging Het
Fcgr3 T A 1: 171,057,750 Y102F probably damaging Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Herc1 T A 9: 66,479,009 V3748D probably damaging Het
Ino80d A G 1: 63,085,986 S106P probably benign Het
Kcns3 C T 12: 11,092,748 probably benign Het
Kndc1 T A 7: 139,932,917 L1527Q probably damaging Het
Lepr T G 4: 101,779,983 S690A probably benign Het
Lrfn5 T C 12: 61,843,557 F544S probably damaging Het
Mapkap1 C A 2: 34,619,849 H450Q probably damaging Het
Mdm1 A G 10: 118,158,540 T485A probably benign Het
Megf10 T C 18: 57,277,688 C690R probably damaging Het
Myo7a A G 7: 98,063,599 M1723T probably benign Het
Nrip3 A T 7: 109,765,507 C137* probably null Het
Olfr153 T A 2: 87,532,780 I249N probably damaging Het
Pde4a T A 9: 21,211,001 M731K probably benign Het
Pebp1 A G 5: 117,283,462 L117P probably damaging Het
Phc2 T C 4: 128,705,202 Y51H probably damaging Het
Ppp2r5b A G 19: 6,234,683 F50S probably benign Het
Prpf4b A G 13: 34,899,842 S865G probably benign Het
Ptpn5 C T 7: 47,088,606 V243M probably benign Het
Rora T C 9: 69,364,559 L273P possibly damaging Het
Rtp4 T A 16: 23,613,454 S245R probably benign Het
Scgb2b20 C T 7: 33,364,560 G95D probably benign Het
Sec24b A G 3: 129,994,391 V820A probably benign Het
Sim2 A G 16: 94,094,309 D62G possibly damaging Het
Sp2 T C 11: 96,961,973 T42A probably damaging Het
Spata3 G A 1: 86,024,447 R141Q unknown Het
Sptbn2 A T 19: 4,745,577 E1658D probably benign Het
Tcaf1 T C 6: 42,678,539 H501R probably benign Het
Tec G A 5: 72,773,835 T262M possibly damaging Het
Timm9 A T 12: 71,125,531 N22K possibly damaging Het
Tln1 C T 4: 43,542,701 probably null Het
Tmbim4 A G 10: 120,217,624 I109M probably benign Het
Tmc7 T C 7: 118,564,343 K110E probably benign Het
Tmem107 C T 11: 69,072,573 P136L probably benign Het
Ttc21b T C 2: 66,231,219 probably null Het
Ubd A C 17: 37,195,444 T74P probably damaging Het
Vps11 A G 9: 44,358,189 V255A possibly damaging Het
Vsnl1 T C 12: 11,326,447 T146A probably benign Het
Wdr38 G T 2: 38,999,972 probably null Het
Yes1 T A 5: 32,684,625 S498T possibly damaging Het
Zc3h13 G A 14: 75,331,883 R1390H probably damaging Het
Zscan4b A G 7: 10,902,022 V126A possibly damaging Het
Other mutations in Slc17a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01724:Slc17a4 APN 13 23905533 missense probably benign 0.06
IGL02976:Slc17a4 APN 13 23905424 missense probably damaging 0.99
PIT4581001:Slc17a4 UTSW 13 23902018 missense probably damaging 0.99
R1490:Slc17a4 UTSW 13 23904753 missense probably benign 0.29
R1726:Slc17a4 UTSW 13 23905591 nonsense probably null
R1866:Slc17a4 UTSW 13 23900545 missense possibly damaging 0.67
R3820:Slc17a4 UTSW 13 23901769 missense probably benign
R3821:Slc17a4 UTSW 13 23901769 missense probably benign
R3837:Slc17a4 UTSW 13 23901769 missense probably benign
R3838:Slc17a4 UTSW 13 23901769 missense probably benign
R3839:Slc17a4 UTSW 13 23901769 missense probably benign
R5347:Slc17a4 UTSW 13 23908817 missense possibly damaging 0.63
R5489:Slc17a4 UTSW 13 23898842 splice site probably null
R6607:Slc17a4 UTSW 13 23905414 splice site probably null
R7614:Slc17a4 UTSW 13 23906597 missense probably benign 0.02
R7730:Slc17a4 UTSW 13 23900520 nonsense probably null
R7744:Slc17a4 UTSW 13 23901784 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TAAGCTGGGAATGCAGGTATATTGG -3'
(R):5'- GTTGACATGTTAGCACAGGC -3'

Sequencing Primer
(F):5'- GGGGTTCCAGACTCATGAGC -3'
(R):5'- TATCCCCTGAAAGGCTGAGC -3'
Posted On2019-06-07