Incidental Mutation 'R3838:Slc17a4'
ID277013
Institutional Source Beutler Lab
Gene Symbol Slc17a4
Ensembl Gene ENSMUSG00000021336
Gene Namesolute carrier family 17 (sodium phosphate), member 4
Synonyms
MMRRC Submission 040779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3838 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23895890-23915009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23901769 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 387 (R387H)
Ref Sequence ENSEMBL: ENSMUSP00000106037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021769] [ENSMUST00000110407] [ENSMUST00000225797]
Predicted Effect probably benign
Transcript: ENSMUST00000021769
AA Change: R387H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021769
Gene: ENSMUSG00000021336
AA Change: R387H

DomainStartEndE-ValueType
Pfam:MFS_1 40 373 1.4e-48 PFAM
Pfam:MFS_1 361 492 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110407
AA Change: R387H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106037
Gene: ENSMUSG00000021336
AA Change: R387H

DomainStartEndE-ValueType
Pfam:MFS_1 40 371 1.7e-47 PFAM
Pfam:MFS_1 359 490 3.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225763
Predicted Effect probably benign
Transcript: ENSMUST00000225797
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphate homeostasis is maintained by regulating intake, intestinal absorption, bone deposition and resorption, and renal excretion of phosphate. The central molecule in the control of phosphate excretion from the kidney is the sodium/phosphate cotransporter NPT1 (SLC17A1; MIM 182308), which is located in the renal proximal tubule. NPT1 uses the transmembrane electrochemical potential gradient of sodium to transport phosphate across the cell membrane. SLC17A4 is a similar sodium/phosphate cotransporter in the intestinal mucosa that plays an important role in the absorption of phosphate from the intestine (summary by Shibui et al., 1999 [PubMed 10319585]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,521 T41A probably benign Het
4930486L24Rik A G 13: 60,845,227 Y213H probably damaging Het
Alg8 C T 7: 97,388,545 H379Y probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Arid4a A G 12: 71,075,785 E980G possibly damaging Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
Bud13 A C 9: 46,290,192 Q387P possibly damaging Het
Champ1 A G 8: 13,879,939 Y699C probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Col2a1 T C 15: 97,988,976 D345G unknown Het
Col2a1 A T 15: 98,000,581 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Dnajb2 G A 1: 75,241,480 probably null Het
Dock4 G T 12: 40,794,624 probably null Het
Epx A T 11: 87,874,830 L101Q probably damaging Het
F13a1 A T 13: 37,047,424 N21K probably damaging Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a T C 14: 34,245,368 D77G probably benign Het
Foxj3 T A 4: 119,616,624 H215Q possibly damaging Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Ighmbp2 T C 19: 3,271,658 Y367C probably benign Het
Lrrc14b A G 13: 74,363,545 C139R possibly damaging Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Myh7b A G 2: 155,632,989 K1816E probably damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nme2 T A 11: 93,949,977 E252D probably benign Het
Ntpcr G A 8: 125,737,372 V79M probably damaging Het
Ogdh C T 11: 6,338,627 R235* probably null Het
Olfr1490 A G 19: 13,654,957 D176G probably benign Het
Olfr825 C A 10: 130,162,406 E307* probably null Het
Olfr959 A G 9: 39,572,971 V96A probably benign Het
Pcdh20 T C 14: 88,468,463 N467S probably benign Het
Pkhd1 G A 1: 20,534,629 T1154I possibly damaging Het
Polq G T 16: 37,078,349 R2157I probably damaging Het
Reep6 C A 10: 80,335,889 A533E probably damaging Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Sept11 T A 5: 93,148,399 I52N probably damaging Het
Spdye4b C T 5: 143,192,329 T11I probably benign Het
Srrt C T 5: 137,302,125 probably null Het
Sspo T A 6: 48,480,820 C3085S probably damaging Het
Stim1 C T 7: 102,411,296 T182I possibly damaging Het
Thbs2 C A 17: 14,687,851 V217L probably benign Het
Thpo G A 16: 20,728,748 R38C probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Trim12c T A 7: 104,340,868 probably benign Het
Tvp23b A G 11: 62,883,629 H33R possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r73 A G 7: 85,858,050 W685R probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp715 A G 7: 43,299,756 V260A probably benign Het
Other mutations in Slc17a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01724:Slc17a4 APN 13 23905533 missense probably benign 0.06
IGL02976:Slc17a4 APN 13 23905424 missense probably damaging 0.99
PIT4581001:Slc17a4 UTSW 13 23902018 missense probably damaging 0.99
PIT4696001:Slc17a4 UTSW 13 23900514 missense probably benign 0.02
R1490:Slc17a4 UTSW 13 23904753 missense probably benign 0.29
R1726:Slc17a4 UTSW 13 23905591 nonsense probably null
R1866:Slc17a4 UTSW 13 23900545 missense possibly damaging 0.67
R3820:Slc17a4 UTSW 13 23901769 missense probably benign
R3821:Slc17a4 UTSW 13 23901769 missense probably benign
R3837:Slc17a4 UTSW 13 23901769 missense probably benign
R3839:Slc17a4 UTSW 13 23901769 missense probably benign
R5347:Slc17a4 UTSW 13 23908817 missense possibly damaging 0.63
R5489:Slc17a4 UTSW 13 23898842 splice site probably null
R6607:Slc17a4 UTSW 13 23905414 splice site probably null
R7614:Slc17a4 UTSW 13 23906597 missense probably benign 0.02
R7730:Slc17a4 UTSW 13 23900520 nonsense probably null
R7744:Slc17a4 UTSW 13 23901784 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATGGAGATGTAGCACCGATG -3'
(R):5'- CTCCGACTTGTCACTATCAGG -3'

Sequencing Primer
(F):5'- AGATGTAGCACCGATGTTACTCTGC -3'
(R):5'- ATCAGGAAGCTCTTCACTGCTGTAG -3'
Posted On2015-04-06