Mutagenetix > Incidental Mutation

Incidental Mutation 'R0585:Rps5'

55710

Institutional Source

Beutler Lab

Gene Symbol

Rps5

Ensembl Gene

ENSMUSG00000012848

Gene Name

ribosomal protein S5

Synonyms

S5 ribosomal protein

MMRRC Submission

038775-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R0585 (G1)

Quality Score

210

Status

Validated

Chromosome

Chromosomal Location

12656223-12660613 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12659332 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 41 (V41A)

Ref Sequence

ENSEMBL: ENSMUSP00000118798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004554] [ENSMUST00000045870] [ENSMUST00000108539] [ENSMUST00000137329] [ENSMUST00000147435]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000004554
AA Change: V41A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000004554
Gene: ENSMUSG00000012848
AA Change: V41A

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S7	49	204	3.5e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000045870

SMART Domains

Protein: ENSMUSP00000042816
Gene: ENSMUSG00000033967

Domain	Start	End	E-Value	Type
low complexity region	14	27	N/A	INTRINSIC
low complexity region	35	47	N/A	INTRINSIC
RING	63	110	2.91e-6	SMART
low complexity region	150	170	N/A	INTRINSIC
low complexity region	175	196	N/A	INTRINSIC
transmembrane domain	202	224	N/A	INTRINSIC
low complexity region	266	278	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108539
AA Change: V41A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000104179
Gene: ENSMUSG00000012848
AA Change: V41A

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S7	51	204	1.8e-40	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131795

Predicted Effect

possibly damaging
Transcript: ENSMUST00000137329
AA Change: V41A

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000121961
Gene: ENSMUSG00000012848
AA Change: V41A

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S7	49	182	1.2e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139349

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147435
AA Change: V41A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118798
Gene: ENSMUSG00000012848
AA Change: V41A

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S7	49	182	1.2e-34	PFAM

Meta Mutation Damage Score

0.1784

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.2%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S7P family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Brdt	T	G	5: 107,504,748 (GRCm39)		probably null	Het
Ccdc162	C	T	10: 41,462,375 (GRCm39)	C1474Y	probably benign	Het
Ces2e	T	C	8: 105,656,453 (GRCm39)	S228P	probably damaging	Het
Clca3a1	G	T	3: 144,738,386 (GRCm39)	H41N	probably benign	Het
Cyp2c39	A	T	19: 39,525,203 (GRCm39)	I169F	probably benign	Het
Cyp2c65	A	G	19: 39,057,686 (GRCm39)	K107R	probably benign	Het
Cyp2c67	T	A	19: 39,627,138 (GRCm39)	N231Y	possibly damaging	Het
Eps8l3	G	C	3: 107,788,513 (GRCm39)	D33H	probably damaging	Het
Evi5	T	C	5: 107,961,402 (GRCm39)		probably benign	Het
Fcho1	T	C	8: 72,168,369 (GRCm39)	Y218C	probably damaging	Het
Gm3993	T	A	12: 20,122,149 (GRCm39)		probably null	Het
Gtf2ird1	A	C	5: 134,405,796 (GRCm39)	L28R	probably damaging	Het
Hsf4	A	G	8: 105,997,663 (GRCm39)	D75G	probably damaging	Het
Iqca1l	A	G	5: 24,755,721 (GRCm39)	V267A	probably benign	Het
Larp4b	A	G	13: 9,197,529 (GRCm39)	T249A	probably damaging	Het
Larp4b	A	G	13: 9,220,737 (GRCm39)	D578G	probably benign	Het
Lyz3	T	A	10: 117,074,356 (GRCm39)	I44F	possibly damaging	Het
Matn3	A	T	12: 9,011,103 (GRCm39)		probably benign	Het
Myo10	T	A	15: 25,736,541 (GRCm39)	Y428N	probably damaging	Het
Nf1	T	A	11: 79,459,527 (GRCm39)	D661E	probably damaging	Het
Nktr	A	G	9: 121,583,346 (GRCm39)		probably benign	Het
Npbwr1	G	A	1: 5,986,677 (GRCm39)	T279I	possibly damaging	Het
Or52n3	A	C	7: 104,530,706 (GRCm39)	H264P	probably damaging	Het
Osmr	T	C	15: 6,867,274 (GRCm39)	I341V	probably benign	Het
Pan2	T	C	10: 128,146,384 (GRCm39)		probably null	Het
Pknox2	G	A	9: 36,821,056 (GRCm39)		probably benign	Het
Pla2g2d	A	C	4: 138,506,704 (GRCm39)	D50A	probably benign	Het
Ptprk	C	T	10: 28,451,664 (GRCm39)	L1051F	probably damaging	Het
Rap1gds1	G	A	3: 138,727,633 (GRCm39)	T59M	probably benign	Het
Ryr1	G	T	7: 28,735,501 (GRCm39)	D4092E	probably damaging	Het
Spic	T	C	10: 88,511,905 (GRCm39)	Y117C	probably damaging	Het
Thrap3	A	T	4: 126,072,367 (GRCm39)		probably null	Het
Tlr9	C	T	9: 106,102,275 (GRCm39)	T522I	probably benign	Het
Tspan3	A	T	9: 56,053,216 (GRCm39)		probably benign	Het
Ttn	T	C	2: 76,703,503 (GRCm39)		probably benign	Het
Zfp773	T	A	7: 7,135,574 (GRCm39)	I341L	probably benign	Het
Zmat3	G	A	3: 32,415,254 (GRCm39)	P19S	probably damaging	Het

Other mutations in Rps5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R2474:Rps5	UTSW	7	12,660,488 (GRCm39)	splice site	probably null
R5750:Rps5	UTSW	7	12,659,334 (GRCm39)	missense	probably damaging	1.00
R5861:Rps5	UTSW	7	12,659,501 (GRCm39)	missense	probably damaging	0.96
R6905:Rps5	UTSW	7	12,659,785 (GRCm39)	missense	probably damaging	0.98
R7443:Rps5	UTSW	7	12,656,922 (GRCm39)	missense	probably benign
R8955:Rps5	UTSW	7	12,659,440 (GRCm39)	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- GGGCAGCACTTTCCCCTTTTATGAATG -3'
(R):5'- TTACCTCACCAGTGAGCAGGTGGATG -3'

Sequencing Primer
(F):5'- CCCTTTTATGAATGGGAGTGTGAC -3'
(R):5'- CAGTGAGCAGGTGGATGATCTC -3'

Posted On

2013-07-11