Incidental Mutation 'R7168:R3hdm1'
ID558031
Institutional Source Beutler Lab
Gene Symbol R3hdm1
Ensembl Gene ENSMUSG00000056211
Gene NameR3H domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7168 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location128103301-128237736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128216495 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 800 (T800I)
Ref Sequence ENSEMBL: ENSMUSP00000043103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036288]
Predicted Effect probably benign
Transcript: ENSMUST00000036288
AA Change: T800I

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000043103
Gene: ENSMUSG00000056211
AA Change: T800I

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 8.8e-15 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 624 642 N/A INTRINSIC
low complexity region 909 927 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,216,057 D1388V probably damaging Het
2810474O19Rik T G 6: 149,327,843 F796V probably benign Het
2900026A02Rik C A 5: 113,137,793 R65L probably damaging Het
Abcb10 A T 8: 123,966,611 L318Q Het
Abhd18 T A 3: 40,934,936 V417D probably damaging Het
Actl7a A G 4: 56,743,769 K99E probably benign Het
Adam2 A T 14: 66,058,792 I206N possibly damaging Het
Adgrv1 G T 13: 81,397,209 S5652R possibly damaging Het
Aebp2 C T 6: 140,633,700 T221M probably damaging Het
Ahi1 T A 10: 21,017,932 M854K probably benign Het
Alpi T A 1: 87,099,433 T375S possibly damaging Het
Apip T A 2: 103,092,468 C210* probably null Het
Arid3b A T 9: 57,805,535 D232E probably benign Het
Asic5 G A 3: 82,011,975 C342Y probably damaging Het
BC035947 T C 1: 78,499,593 M101V probably benign Het
Brd3 G A 2: 27,454,399 R440C possibly damaging Het
Deaf1 C T 7: 141,324,596 probably benign Het
Eif2ak3 A G 6: 70,881,626 T300A probably benign Het
Eml6 T A 11: 29,838,529 I519F probably benign Het
Fat4 T C 3: 38,980,659 F2820S probably damaging Het
Fcho2 A G 13: 98,789,463 I132T probably benign Het
Garnl3 A G 2: 32,995,078 V810A probably damaging Het
Gm14403 A C 2: 177,509,525 Q179P probably damaging Het
Gm3127 A G 14: 4,172,501 M251V probably benign Het
Hook3 A G 8: 26,071,086 S298P probably benign Het
Impact T A 18: 12,986,313 probably null Het
Itgal T C 7: 127,330,213 F1101L probably benign Het
Itih1 C T 14: 30,934,107 R579Q probably null Het
Kansl2 T C 15: 98,529,544 probably null Het
Kng1 A G 16: 23,079,641 D597G probably benign Het
Kpna1 A G 16: 36,015,962 probably benign Het
Lama2 C T 10: 27,366,152 probably null Het
Ltbp1 G T 17: 75,291,366 C614F probably damaging Het
Luc7l3 T C 11: 94,299,984 E168G unknown Het
Lvrn A C 18: 46,881,322 K525T probably benign Het
Mdn1 G A 4: 32,719,184 R2249H probably damaging Het
Mmp16 G T 4: 18,110,550 G449C probably damaging Het
Mst1r T C 9: 107,908,193 V350A probably benign Het
Muc5b A G 7: 141,864,017 M3567V probably benign Het
Mybl1 A T 1: 9,678,288 L361Q probably damaging Het
Myom1 T A 17: 71,089,947 S1063R probably benign Het
Notch4 A C 17: 34,572,693 H582P probably benign Het
Nwd2 T A 5: 63,807,494 C1474S probably benign Het
Olfr1163 A C 2: 88,070,577 N268K probably benign Het
Olfr1284 A T 2: 111,379,879 D293V probably damaging Het
Olfr1338 A T 4: 118,753,851 I231N probably damaging Het
Olfr889 G T 9: 38,116,663 S294I probably damaging Het
Pcmt1 A T 10: 7,638,182 V241D probably damaging Het
Plcl1 T A 1: 55,697,463 N654K probably damaging Het
Plg G A 17: 12,388,559 G121D probably damaging Het
Ptch1 A G 13: 63,512,060 S1260P probably benign Het
Pwp1 G T 10: 85,884,537 R346I probably damaging Het
Rab3gap2 A G 1: 185,204,297 D19G possibly damaging Het
Slc1a3 G T 15: 8,645,902 N206K possibly damaging Het
Slc6a3 T C 13: 73,571,472 V540A probably benign Het
Sntb1 G A 15: 55,791,265 P265S probably benign Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tm2d3 T A 7: 65,693,926 V56E probably benign Het
Trhr2 T A 8: 122,360,537 T55S probably damaging Het
Trim17 T G 11: 58,968,578 V206G probably benign Het
Trpm1 A G 7: 64,268,697 N1479S probably benign Het
Trpv2 T A 11: 62,583,088 C190S probably benign Het
Umod A T 7: 119,478,326 probably benign Het
Usp34 T A 11: 23,464,585 Y2862N Het
Vmn1r158 A G 7: 22,790,676 V36A possibly damaging Het
Zfp420 A G 7: 29,875,366 Y337C probably damaging Het
Other mutations in R3hdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:R3hdm1 APN 1 128236439 missense probably damaging 1.00
IGL00799:R3hdm1 APN 1 128174963 missense probably damaging 1.00
IGL00835:R3hdm1 APN 1 128235632 splice site probably benign
IGL00885:R3hdm1 APN 1 128236438 missense probably damaging 0.99
IGL00990:R3hdm1 APN 1 128162196 intron probably benign
IGL01137:R3hdm1 APN 1 128181875 missense probably damaging 1.00
IGL01323:R3hdm1 APN 1 128216543 missense probably benign
IGL01461:R3hdm1 APN 1 128178906 missense probably damaging 1.00
IGL01565:R3hdm1 APN 1 128186816 missense probably damaging 1.00
IGL01813:R3hdm1 APN 1 128175233 critical splice donor site probably null
IGL01837:R3hdm1 APN 1 128186760 nonsense probably null
IGL01934:R3hdm1 APN 1 128236535 missense probably benign 0.12
IGL02074:R3hdm1 APN 1 128169038 missense possibly damaging 0.48
IGL02532:R3hdm1 APN 1 128197099 critical splice donor site probably null
IGL02606:R3hdm1 APN 1 128190719 missense probably benign 0.00
IGL02851:R3hdm1 APN 1 128174940 splice site probably benign
driven UTSW 1 128193565 missense probably benign 0.00
R0023:R3hdm1 UTSW 1 128211192 splice site probably benign
R0280:R3hdm1 UTSW 1 128162775 missense probably benign 0.00
R0482:R3hdm1 UTSW 1 128184517 missense probably benign 0.12
R0521:R3hdm1 UTSW 1 128193703 missense probably benign 0.07
R0578:R3hdm1 UTSW 1 128231437 nonsense probably null
R0698:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0701:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0961:R3hdm1 UTSW 1 128193596 missense probably benign 0.13
R1026:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1141:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1319:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1320:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1511:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1705:R3hdm1 UTSW 1 128235084 missense probably damaging 1.00
R1991:R3hdm1 UTSW 1 128169016 missense probably damaging 0.99
R2140:R3hdm1 UTSW 1 128190693 missense probably damaging 0.99
R2437:R3hdm1 UTSW 1 128186836 missense probably damaging 0.98
R2447:R3hdm1 UTSW 1 128186929 intron probably benign
R4564:R3hdm1 UTSW 1 128221659 missense probably benign 0.16
R4640:R3hdm1 UTSW 1 128175238 splice site probably benign
R4649:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4650:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4652:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4653:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4696:R3hdm1 UTSW 1 128236766 utr 3 prime probably benign
R5393:R3hdm1 UTSW 1 128231347 missense probably benign
R5554:R3hdm1 UTSW 1 128236672 missense probably benign 0.27
R5979:R3hdm1 UTSW 1 128211223 missense probably benign 0.04
R6123:R3hdm1 UTSW 1 128169036 missense probably damaging 0.99
R6185:R3hdm1 UTSW 1 128151861 missense possibly damaging 0.93
R6618:R3hdm1 UTSW 1 128193565 missense probably benign 0.00
R6636:R3hdm1 UTSW 1 128162811 frame shift probably null
R6639:R3hdm1 UTSW 1 128162811 frame shift probably null
R6756:R3hdm1 UTSW 1 128162811 frame shift probably null
R7210:R3hdm1 UTSW 1 128211208 missense possibly damaging 0.95
R7367:R3hdm1 UTSW 1 128153392 missense possibly damaging 0.64
R7536:R3hdm1 UTSW 1 128182211 splice site probably null
R7896:R3hdm1 UTSW 1 128168966 splice site probably null
R7979:R3hdm1 UTSW 1 128168966 splice site probably null
X0017:R3hdm1 UTSW 1 128167921 missense possibly damaging 0.92
X0020:R3hdm1 UTSW 1 128169033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCACGTAGACCATTGTG -3'
(R):5'- CAGGGAATGGAATGATTAGCTTATG -3'

Sequencing Primer
(F):5'- CCATTGTGGTGATGTTGTGGTAAGC -3'
(R):5'- TCTAGCACCTATATGGAGGGTCAC -3'
Posted On2019-06-26