Incidental Mutation 'R7168:Slc6a3'
ID558076
Institutional Source Beutler Lab
Gene Symbol Slc6a3
Ensembl Gene ENSMUSG00000021609
Gene Namesolute carrier family 6 (neurotransmitter transporter, dopamine), member 3
SynonymsDat1, DAT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7168 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73536747-73578672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73571472 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 540 (V540A)
Ref Sequence ENSEMBL: ENSMUSP00000022100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022100]
Predicted Effect probably benign
Transcript: ENSMUST00000022100
AA Change: V540A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000022100
Gene: ENSMUSG00000021609
AA Change: V540A

DomainStartEndE-ValueType
Pfam:SNF 60 582 8.1e-237 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dwarfism, hyperactivity (especially in a novel environment), 5-fold higher extracellular dopamine levels, impaired spatial cognitive function, anterior pituitary hypoplasia, and failure to lactate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,216,057 D1388V probably damaging Het
2810474O19Rik T G 6: 149,327,843 F796V probably benign Het
2900026A02Rik C A 5: 113,137,793 R65L probably damaging Het
Abcb10 A T 8: 123,966,611 L318Q Het
Abhd18 T A 3: 40,934,936 V417D probably damaging Het
Actl7a A G 4: 56,743,769 K99E probably benign Het
Adam2 A T 14: 66,058,792 I206N possibly damaging Het
Adgrv1 G T 13: 81,397,209 S5652R possibly damaging Het
Aebp2 C T 6: 140,633,700 T221M probably damaging Het
Ahi1 T A 10: 21,017,932 M854K probably benign Het
Alpi T A 1: 87,099,433 T375S possibly damaging Het
Apip T A 2: 103,092,468 C210* probably null Het
Arid3b A T 9: 57,805,535 D232E probably benign Het
Asic5 G A 3: 82,011,975 C342Y probably damaging Het
BC035947 T C 1: 78,499,593 M101V probably benign Het
Brd3 G A 2: 27,454,399 R440C possibly damaging Het
Deaf1 C T 7: 141,324,596 probably benign Het
Eif2ak3 A G 6: 70,881,626 T300A probably benign Het
Eml6 T A 11: 29,838,529 I519F probably benign Het
Fat4 T C 3: 38,980,659 F2820S probably damaging Het
Fcho2 A G 13: 98,789,463 I132T probably benign Het
Garnl3 A G 2: 32,995,078 V810A probably damaging Het
Gm14403 A C 2: 177,509,525 Q179P probably damaging Het
Gm3127 A G 14: 4,172,501 M251V probably benign Het
Hook3 A G 8: 26,071,086 S298P probably benign Het
Impact T A 18: 12,986,313 probably null Het
Itgal T C 7: 127,330,213 F1101L probably benign Het
Itih1 C T 14: 30,934,107 R579Q probably null Het
Kansl2 T C 15: 98,529,544 probably null Het
Kng1 A G 16: 23,079,641 D597G probably benign Het
Kpna1 A G 16: 36,015,962 probably benign Het
Lama2 C T 10: 27,366,152 probably null Het
Ltbp1 G T 17: 75,291,366 C614F probably damaging Het
Luc7l3 T C 11: 94,299,984 E168G unknown Het
Lvrn A C 18: 46,881,322 K525T probably benign Het
Mdn1 G A 4: 32,719,184 R2249H probably damaging Het
Mmp16 G T 4: 18,110,550 G449C probably damaging Het
Mst1r T C 9: 107,908,193 V350A probably benign Het
Muc5b A G 7: 141,864,017 M3567V probably benign Het
Mybl1 A T 1: 9,678,288 L361Q probably damaging Het
Myom1 T A 17: 71,089,947 S1063R probably benign Het
Notch4 A C 17: 34,572,693 H582P probably benign Het
Nwd2 T A 5: 63,807,494 C1474S probably benign Het
Olfr1163 A C 2: 88,070,577 N268K probably benign Het
Olfr1284 A T 2: 111,379,879 D293V probably damaging Het
Olfr1338 A T 4: 118,753,851 I231N probably damaging Het
Olfr889 G T 9: 38,116,663 S294I probably damaging Het
Pcmt1 A T 10: 7,638,182 V241D probably damaging Het
Plcl1 T A 1: 55,697,463 N654K probably damaging Het
Plg G A 17: 12,388,559 G121D probably damaging Het
Ptch1 A G 13: 63,512,060 S1260P probably benign Het
Pwp1 G T 10: 85,884,537 R346I probably damaging Het
R3hdm1 C T 1: 128,216,495 T800I probably benign Het
Rab3gap2 A G 1: 185,204,297 D19G possibly damaging Het
Slc1a3 G T 15: 8,645,902 N206K possibly damaging Het
Sntb1 G A 15: 55,791,265 P265S probably benign Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tm2d3 T A 7: 65,693,926 V56E probably benign Het
Trhr2 T A 8: 122,360,537 T55S probably damaging Het
Trim17 T G 11: 58,968,578 V206G probably benign Het
Trpm1 A G 7: 64,268,697 N1479S probably benign Het
Trpv2 T A 11: 62,583,088 C190S probably benign Het
Umod A T 7: 119,478,326 probably benign Het
Usp34 T A 11: 23,464,585 Y2862N Het
Vmn1r158 A G 7: 22,790,676 V36A possibly damaging Het
Zfp420 A G 7: 29,875,366 Y337C probably damaging Het
Other mutations in Slc6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc6a3 APN 13 73544741 missense probably damaging 1.00
IGL01524:Slc6a3 APN 13 73538549 missense probably benign 0.01
IGL02015:Slc6a3 APN 13 73544714 missense possibly damaging 0.60
IGL03008:Slc6a3 APN 13 73558285 critical splice donor site probably null
IGL03029:Slc6a3 APN 13 73538697 missense probably damaging 1.00
IGL03064:Slc6a3 APN 13 73571466 missense probably damaging 0.99
IGL03272:Slc6a3 APN 13 73540929 missense probably damaging 0.98
IGL03294:Slc6a3 APN 13 73557181 critical splice donor site probably null
IGL03345:Slc6a3 APN 13 73571514 missense probably benign
IGL03410:Slc6a3 APN 13 73538657 missense probably benign 0.03
disney UTSW 13 73544884 missense probably benign
dopey UTSW 13 73560959 missense probably damaging 1.00
Dopey2 UTSW 13 73544817 missense probably damaging 1.00
Stiff UTSW 13 73557050 missense possibly damaging 0.85
PIT4382001:Slc6a3 UTSW 13 73571523 missense probably benign 0.35
R0024:Slc6a3 UTSW 13 73540837 splice site probably benign
R0125:Slc6a3 UTSW 13 73569979 splice site probably benign
R0180:Slc6a3 UTSW 13 73562336 missense probably damaging 1.00
R0288:Slc6a3 UTSW 13 73560928 missense probably damaging 1.00
R0322:Slc6a3 UTSW 13 73560926 missense possibly damaging 0.61
R0349:Slc6a3 UTSW 13 73567557 missense probably damaging 1.00
R0411:Slc6a3 UTSW 13 73557050 missense possibly damaging 0.85
R0594:Slc6a3 UTSW 13 73538642 missense probably damaging 0.99
R0680:Slc6a3 UTSW 13 73538727 missense probably damaging 1.00
R1099:Slc6a3 UTSW 13 73567641 missense probably benign 0.21
R1109:Slc6a3 UTSW 13 73557080 missense probably benign 0.00
R1791:Slc6a3 UTSW 13 73566292 missense possibly damaging 0.82
R3916:Slc6a3 UTSW 13 73562308 missense probably benign 0.00
R4279:Slc6a3 UTSW 13 73544834 missense possibly damaging 0.90
R4368:Slc6a3 UTSW 13 73560912 nonsense probably null
R4520:Slc6a3 UTSW 13 73540856 missense possibly damaging 0.95
R4666:Slc6a3 UTSW 13 73538581 missense possibly damaging 0.47
R4675:Slc6a3 UTSW 13 73544817 missense probably damaging 1.00
R4716:Slc6a3 UTSW 13 73557076 missense probably benign 0.04
R5243:Slc6a3 UTSW 13 73571451 missense possibly damaging 0.61
R5355:Slc6a3 UTSW 13 73560959 missense probably damaging 1.00
R5681:Slc6a3 UTSW 13 73538735 missense probably damaging 0.99
R5737:Slc6a3 UTSW 13 73544804 missense probably damaging 0.99
R6142:Slc6a3 UTSW 13 73544783 missense probably benign 0.00
R6471:Slc6a3 UTSW 13 73544884 missense probably benign
R7403:Slc6a3 UTSW 13 73562427 critical splice donor site probably null
R8282:Slc6a3 UTSW 13 73557081 missense probably benign 0.01
R8359:Slc6a3 UTSW 13 73544883 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGCCATTGGTGCCTCAGG -3'
(R):5'- TATGGTCCAGGGATGGAGAC -3'

Sequencing Primer
(F):5'- CCATTGGTGCCTCAGGAAGATATTG -3'
(R):5'- GAACCATTAGAATGATGAACCCCTTG -3'
Posted On2019-06-26