Mutagenetix > Incidental Mutation

Incidental Mutation 'R0588:Cabin1'

55842

Institutional Source

Beutler Lab

Gene Symbol

Cabin1

Ensembl Gene

ENSMUSG00000020196

Gene Name

calcineurin binding protein 1

Synonyms

A330070M20Rik, Ppp3in, Cain

MMRRC Submission

038778-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0588 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

75481946-75600175 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75581171 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 385 (E385G)

Ref Sequence

ENSEMBL: ENSMUSP00000001712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001712]

AlphaFold

G3X8Q1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000001712
AA Change: E385G

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000001712
Gene: ENSMUSG00000020196
AA Change: E385G

Domain	Start	End	E-Value	Type
low complexity region	61	71	N/A	INTRINSIC
TPR	90	123	4.15e-2	SMART
TPR	124	157	5.69e0	SMART
low complexity region	312	326	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
TPR	615	648	9.7e0	SMART
low complexity region	740	750	N/A	INTRINSIC
low complexity region	882	892	N/A	INTRINSIC
TPR	1055	1088	6.92e1	SMART
low complexity region	1327	1349	N/A	INTRINSIC
low complexity region	1714	1727	N/A	INTRINSIC
low complexity region	1778	1790	N/A	INTRINSIC
low complexity region	1791	1803	N/A	INTRINSIC
low complexity region	1810	1831	N/A	INTRINSIC
low complexity region	1941	1956	N/A	INTRINSIC
Pfam:MEF2_binding	2123	2157	5.7e-26	PFAM
low complexity region	2165	2183	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218951

Meta Mutation Damage Score

0.0639

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.8%

Validation Efficiency

100% (25/25)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin plays an important role in the T-cell receptor-mediated signal transduction pathway. The protein encoded by this gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The encoded protein is found in the nucleus and contains a leucine zipper domain as well as several PEST motifs, sequences which confer targeted degradation to those proteins which contain them. Alternative splicing results in multiple transcript variants encoding two different isoforms. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mutants exhibit embryonic lethality during organogenesis. Mice producing a truncated protein exhibit elevated levels of serum IgG1, IgG2b and IgE, produce more IgG1 in response to T-cell dependent antigen, and have enhanced expression of cytokines in response to anti-CD3 stimulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	T	A	6: 142,548,787 (GRCm39)	K1299*	probably null	Het
Adamts2	G	T	11: 50,667,491 (GRCm39)	W476C	probably damaging	Het
Ankrd13c	T	C	3: 157,711,454 (GRCm39)	F525L	probably damaging	Het
Arg1	T	C	10: 24,796,522 (GRCm39)	S102G	probably damaging	Het
Atp2a3	A	T	11: 72,863,850 (GRCm39)	D192V	possibly damaging	Het
Cacna1h	A	T	17: 25,606,538 (GRCm39)	D1020E	probably damaging	Het
Calcb	C	T	7: 114,319,361 (GRCm39)	H48Y	probably benign	Het
Crtc1	A	G	8: 70,892,199 (GRCm39)	S4P	probably damaging	Het
Dcaf6	A	G	1: 165,247,792 (GRCm39)	I147T	possibly damaging	Het
Ears2	T	C	7: 121,643,514 (GRCm39)		probably benign	Het
Fas	T	C	19: 34,304,540 (GRCm39)	V267A	probably damaging	Het
Fus	T	C	7: 127,584,746 (GRCm39)	L84P	probably damaging	Het
Fyb1	T	C	15: 6,609,940 (GRCm39)	V171A	probably benign	Het
Gdap2	T	A	3: 100,077,317 (GRCm39)	M1K	probably null	Het
Gprc5b	T	A	7: 118,583,218 (GRCm39)	Q217L	probably benign	Het
Lrrc69	A	G	4: 14,704,001 (GRCm39)	I273T	possibly damaging	Het
Map4k4	C	A	1: 40,044,024 (GRCm39)	Q556K	possibly damaging	Het
Npy6r	T	A	18: 44,408,888 (GRCm39)	V103E	possibly damaging	Het
Or5b24	A	G	19: 12,912,111 (GRCm39)	Y3C	probably benign	Het
Shisa9	A	G	16: 12,085,638 (GRCm39)	T416A	probably damaging	Het
Slc26a9	C	A	1: 131,681,749 (GRCm39)		probably benign	Het
Sostdc1	G	T	12: 36,367,020 (GRCm39)		probably benign	Het
St18	T	A	1: 6,887,962 (GRCm39)	F510L	probably damaging	Het
Zdhhc7	A	G	8: 120,810,106 (GRCm39)		probably benign	Het

Other mutations in Cabin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01434:Cabin1	APN	10	75,561,420 (GRCm39)	missense	possibly damaging	0.58
IGL01457:Cabin1	APN	10	75,578,263 (GRCm39)	missense	probably damaging	0.96
IGL02217:Cabin1	APN	10	75,535,881 (GRCm39)	missense	possibly damaging	0.95
IGL02649:Cabin1	APN	10	75,573,252 (GRCm39)	missense	probably damaging	1.00
IGL02737:Cabin1	APN	10	75,549,419 (GRCm39)	missense	probably benign	0.09
IGL02792:Cabin1	APN	10	75,582,573 (GRCm39)	missense	probably damaging	1.00
IGL03047:Cabin1	APN	10	75,535,934 (GRCm39)	splice site	probably benign
IGL03106:Cabin1	APN	10	75,569,462 (GRCm39)	missense	probably benign	0.01
IGL03276:Cabin1	APN	10	75,568,247 (GRCm39)	missense	probably damaging	1.00
bison	UTSW	10	75,520,157 (GRCm39)	missense	probably damaging	1.00
range	UTSW	10	75,494,481 (GRCm39)	missense	probably damaging	1.00
R0335:Cabin1	UTSW	10	75,492,883 (GRCm39)	missense	probably damaging	1.00
R0557:Cabin1	UTSW	10	75,562,751 (GRCm39)	missense	probably damaging	1.00
R0578:Cabin1	UTSW	10	75,549,444 (GRCm39)	missense	probably damaging	0.96
R1115:Cabin1	UTSW	10	75,553,511 (GRCm39)	missense	possibly damaging	0.70
R1120:Cabin1	UTSW	10	75,561,550 (GRCm39)	missense	probably damaging	1.00
R1439:Cabin1	UTSW	10	75,492,640 (GRCm39)	missense	probably damaging	1.00
R1471:Cabin1	UTSW	10	75,530,626 (GRCm39)	missense	probably damaging	1.00
R1794:Cabin1	UTSW	10	75,561,579 (GRCm39)	missense	possibly damaging	0.52
R1844:Cabin1	UTSW	10	75,579,184 (GRCm39)	splice site	probably null
R1959:Cabin1	UTSW	10	75,570,924 (GRCm39)	missense	possibly damaging	0.92
R2008:Cabin1	UTSW	10	75,570,810 (GRCm39)	splice site	probably null
R2279:Cabin1	UTSW	10	75,589,295 (GRCm39)	missense	probably benign
R3150:Cabin1	UTSW	10	75,492,745 (GRCm39)	missense	probably damaging	1.00
R3929:Cabin1	UTSW	10	75,587,452 (GRCm39)	critical splice acceptor site	probably null
R3945:Cabin1	UTSW	10	75,581,093 (GRCm39)	missense	probably damaging	1.00
R3946:Cabin1	UTSW	10	75,581,093 (GRCm39)	missense	probably damaging	1.00
R4206:Cabin1	UTSW	10	75,590,675 (GRCm39)	missense	possibly damaging	0.69
R4812:Cabin1	UTSW	10	75,482,428 (GRCm39)	missense	possibly damaging	0.93
R4944:Cabin1	UTSW	10	75,575,255 (GRCm39)	missense	probably damaging	0.99
R4944:Cabin1	UTSW	10	75,557,197 (GRCm39)	missense	probably damaging	1.00
R5078:Cabin1	UTSW	10	75,557,312 (GRCm39)	missense	probably damaging	1.00
R5082:Cabin1	UTSW	10	75,574,164 (GRCm39)	missense	probably damaging	0.99
R5319:Cabin1	UTSW	10	75,561,549 (GRCm39)	missense	probably damaging	1.00
R5481:Cabin1	UTSW	10	75,570,900 (GRCm39)	missense	probably benign	0.29
R5504:Cabin1	UTSW	10	75,488,843 (GRCm39)	missense	probably benign	0.00
R5710:Cabin1	UTSW	10	75,482,852 (GRCm39)	missense	probably benign	0.00
R5908:Cabin1	UTSW	10	75,557,366 (GRCm39)	missense	probably damaging	1.00
R5975:Cabin1	UTSW	10	75,493,673 (GRCm39)	missense	probably damaging	1.00
R5982:Cabin1	UTSW	10	75,561,394 (GRCm39)	missense	probably benign	0.00
R6038:Cabin1	UTSW	10	75,575,200 (GRCm39)	missense	probably benign	0.02
R6038:Cabin1	UTSW	10	75,575,200 (GRCm39)	missense	probably benign	0.02
R6114:Cabin1	UTSW	10	75,583,805 (GRCm39)	missense	probably benign	0.00
R6285:Cabin1	UTSW	10	75,520,157 (GRCm39)	missense	probably damaging	1.00
R6341:Cabin1	UTSW	10	75,494,573 (GRCm39)	missense	probably damaging	0.98
R6361:Cabin1	UTSW	10	75,562,699 (GRCm39)	missense	possibly damaging	0.91
R6395:Cabin1	UTSW	10	75,582,576 (GRCm39)	missense	probably benign	0.10
R6422:Cabin1	UTSW	10	75,492,626 (GRCm39)	missense	probably damaging	1.00
R6575:Cabin1	UTSW	10	75,561,535 (GRCm39)	missense	possibly damaging	0.90
R6763:Cabin1	UTSW	10	75,582,564 (GRCm39)	missense	probably damaging	0.99
R6845:Cabin1	UTSW	10	75,557,342 (GRCm39)	missense	probably damaging	1.00
R6936:Cabin1	UTSW	10	75,551,592 (GRCm39)	splice site	probably null
R7050:Cabin1	UTSW	10	75,549,376 (GRCm39)	missense	probably damaging	1.00
R7055:Cabin1	UTSW	10	75,579,117 (GRCm39)	missense	probably benign	0.04
R7101:Cabin1	UTSW	10	75,587,401 (GRCm39)	missense	probably benign
R7138:Cabin1	UTSW	10	75,581,187 (GRCm39)	missense	probably damaging	0.98
R7173:Cabin1	UTSW	10	75,582,396 (GRCm39)	missense	probably benign	0.00
R7265:Cabin1	UTSW	10	75,557,257 (GRCm39)	missense
R7284:Cabin1	UTSW	10	75,530,668 (GRCm39)	missense
R7472:Cabin1	UTSW	10	75,494,481 (GRCm39)	missense	probably damaging	1.00
R7571:Cabin1	UTSW	10	75,482,500 (GRCm39)	missense	probably damaging	1.00
R7617:Cabin1	UTSW	10	75,568,277 (GRCm39)	missense	possibly damaging	0.85
R7739:Cabin1	UTSW	10	75,494,492 (GRCm39)	missense	probably damaging	1.00
R7997:Cabin1	UTSW	10	75,569,609 (GRCm39)	missense	probably benign	0.01
R8347:Cabin1	UTSW	10	75,578,201 (GRCm39)	missense	probably damaging	0.98
R8544:Cabin1	UTSW	10	75,585,890 (GRCm39)	missense	probably benign	0.17
R8546:Cabin1	UTSW	10	75,578,101 (GRCm39)	missense	probably damaging	1.00
R8692:Cabin1	UTSW	10	75,587,410 (GRCm39)	missense	probably benign	0.28
R8839:Cabin1	UTSW	10	75,492,650 (GRCm39)	missense	probably benign	0.00
R9010:Cabin1	UTSW	10	75,570,892 (GRCm39)	nonsense	probably null
R9108:Cabin1	UTSW	10	75,492,973 (GRCm39)	missense	possibly damaging	0.94
R9204:Cabin1	UTSW	10	75,530,550 (GRCm39)	missense	probably benign	0.01
R9259:Cabin1	UTSW	10	75,582,576 (GRCm39)	missense	probably benign
R9312:Cabin1	UTSW	10	75,561,569 (GRCm39)	missense	probably benign	0.07
R9421:Cabin1	UTSW	10	75,493,658 (GRCm39)	missense	probably damaging	1.00
R9439:Cabin1	UTSW	10	75,581,069 (GRCm39)	missense	probably damaging	1.00
R9578:Cabin1	UTSW	10	75,590,185 (GRCm39)	missense	probably damaging	0.99
R9645:Cabin1	UTSW	10	75,494,543 (GRCm39)	missense	probably benign	0.36
R9649:Cabin1	UTSW	10	75,575,239 (GRCm39)	missense	probably damaging	0.98
R9711:Cabin1	UTSW	10	75,579,090 (GRCm39)	missense	probably benign	0.02
Z1177:Cabin1	UTSW	10	75,483,957 (GRCm39)	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCCAAGCACTCAGTTCAGTGACATC -3'
(R):5'- AGGACTGCGTGCTGTTGAGAAG -3'

Sequencing Primer
(F):5'- TCTATTCAAGCAAGCATCAAGGG -3'
(R):5'- TGCTGTTGAGAAGAAAGATGTCG -3'

Posted On

2013-07-11