Incidental Mutation 'R7200:Slc13a4'
ID560231
Institutional Source Beutler Lab
Gene Symbol Slc13a4
Ensembl Gene ENSMUSG00000029843
Gene Namesolute carrier family 13 (sodium/sulfate symporters), member 4
Synonyms9630060C05Rik, SUT1, SUT-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R7200 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location35267957-35308131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35287350 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 194 (E194G)
Ref Sequence ENSEMBL: ENSMUSP00000031868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031868]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031868
AA Change: E194G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031868
Gene: ENSMUSG00000029843
AA Change: E194G

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 5 609 3.2e-105 PFAM
Pfam:CitMHS 45 166 1.1e-15 PFAM
Pfam:CitMHS 251 531 8.9e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display lethality before birth, impaired placental sulfate transport, failure of bone ossification, impaired vascular development, hemorrhaging, and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,153,010 M75T unknown Het
2700049A03Rik T G 12: 71,140,906 N105K probably damaging Het
Acvr1c A T 2: 58,315,855 V31E probably damaging Het
Adra1d T A 2: 131,561,250 T307S probably benign Het
Akr1c14 T C 13: 4,081,051 Y248H probably benign Het
Ankub1 T C 3: 57,672,985 T84A probably benign Het
Asb3 C A 11: 30,998,348 S8* probably null Het
AU041133 G A 10: 82,151,101 G196D possibly damaging Het
B4galt7 T C 13: 55,608,342 C214R probably damaging Het
Chd3 A G 11: 69,364,095 S140P possibly damaging Het
Ciz1 T C 2: 32,364,287 L80P probably damaging Het
Col6a4 G A 9: 106,072,249 P729L possibly damaging Het
Cr2 A G 1: 195,163,249 C133R probably damaging Het
Dmgdh T C 13: 93,691,885 L178P probably damaging Het
Dock5 C A 14: 67,771,702 E1448* probably null Het
Elavl1 A G 8: 4,311,767 S2P probably benign Het
Flywch1 T C 17: 23,761,059 H247R possibly damaging Het
Gabpb1 A T 2: 126,639,302 I309N possibly damaging Het
Glrx3 T C 7: 137,464,436 F298L possibly damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Gpc6 G A 14: 117,964,856 V493I probably benign Het
H2-Bl A T 17: 36,081,046 I45N possibly damaging Het
Hadha C T 5: 30,145,317 E78K probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Ldlrad3 G T 2: 102,113,558 F56L probably damaging Het
Ldlrad3 A G 2: 102,113,560 F56L probably damaging Het
Mapk4 A T 18: 73,930,919 S411T possibly damaging Het
Mcm9 A G 10: 53,615,923 M382T Het
Olfr1457 T C 19: 13,095,232 T139A probably benign Het
Olfr720 A T 14: 14,175,477 C202S probably damaging Het
Pacs1 A C 19: 5,156,413 I248S possibly damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plekhg1 T C 10: 3,956,810 S631P Het
Rars2 A T 4: 34,645,747 K221N probably benign Het
Retsat T C 6: 72,606,019 S388P possibly damaging Het
Rft1 G A 14: 30,682,857 probably null Het
Rgsl1 A G 1: 153,785,199 V345A probably benign Het
Rnf38 A T 4: 44,137,620 S320R probably benign Het
Sel1l3 T A 5: 53,144,109 Y722F probably benign Het
Spata17 G A 1: 187,112,503 R300C probably benign Het
Tacc1 G A 8: 25,241,640 probably benign Het
Tc2n T G 12: 101,689,055 I214L probably damaging Het
Tet2 T C 3: 133,487,192 S494G probably benign Het
Tmco5b A T 2: 113,291,377 I179L probably damaging Het
Triobp AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA AGGGACAA 15: 78,966,842 probably benign Het
Trpv1 A G 11: 73,239,586 T173A probably damaging Het
Vmn2r56 C T 7: 12,710,332 G458R probably damaging Het
Vmn2r81 T G 10: 79,270,736 probably null Het
Wfdc15b T A 2: 164,215,117 E80D probably benign Het
Wrn A T 8: 33,322,348 D423E probably benign Het
Zfp775 T A 6: 48,620,481 C430S possibly damaging Het
Other mutations in Slc13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc13a4 APN 6 35289824 missense probably benign 0.01
IGL00975:Slc13a4 APN 6 35274975 missense probably benign 0.18
IGL01069:Slc13a4 APN 6 35268882 missense probably damaging 1.00
IGL01319:Slc13a4 APN 6 35307353 splice site probably null
IGL01560:Slc13a4 APN 6 35271603 splice site probably benign
IGL02125:Slc13a4 APN 6 35278288 missense probably benign 0.23
IGL02415:Slc13a4 APN 6 35283237 critical splice donor site probably null
IGL02888:Slc13a4 APN 6 35268840 missense probably benign 0.10
R0047:Slc13a4 UTSW 6 35287362 missense possibly damaging 0.84
R0047:Slc13a4 UTSW 6 35287362 missense possibly damaging 0.84
R0532:Slc13a4 UTSW 6 35287404 splice site probably null
R0747:Slc13a4 UTSW 6 35278328 missense probably damaging 1.00
R1391:Slc13a4 UTSW 6 35271662 missense probably damaging 0.96
R2106:Slc13a4 UTSW 6 35287864 missense probably damaging 0.99
R2253:Slc13a4 UTSW 6 35280483 missense probably benign 0.00
R3195:Slc13a4 UTSW 6 35268926 missense probably damaging 1.00
R3689:Slc13a4 UTSW 6 35268910 missense possibly damaging 0.87
R3698:Slc13a4 UTSW 6 35274957 missense probably benign 0.06
R3785:Slc13a4 UTSW 6 35287892 missense probably damaging 1.00
R3856:Slc13a4 UTSW 6 35271604 splice site probably null
R5400:Slc13a4 UTSW 6 35301842 nonsense probably null
R6142:Slc13a4 UTSW 6 35301783 missense probably damaging 0.99
R6645:Slc13a4 UTSW 6 35268839 missense probably benign 0.19
R6851:Slc13a4 UTSW 6 35301733 missense probably damaging 1.00
R7513:Slc13a4 UTSW 6 35283337 intron probably null
R7590:Slc13a4 UTSW 6 35279463 missense possibly damaging 0.90
R7673:Slc13a4 UTSW 6 35276476 missense probably damaging 1.00
R7706:Slc13a4 UTSW 6 35270355 missense possibly damaging 0.92
R8056:Slc13a4 UTSW 6 35268952 missense probably damaging 1.00
Z1176:Slc13a4 UTSW 6 35278292 missense probably damaging 0.96
Z1177:Slc13a4 UTSW 6 35289849 missense possibly damaging 0.75
Z1177:Slc13a4 UTSW 6 35289850 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCAAGTGTTCTGGAATTAGGG -3'
(R):5'- TACAAAACTCCGGTGTCTGCC -3'

Sequencing Primer
(F):5'- GGAGACCCCCTCAAGATCGTC -3'
(R):5'- CACTATGCCTTCAGAGCAGAGAG -3'
Posted On2019-06-26