Incidental Mutation 'R7216:Pbrm1'
ID561503
Institutional Source Beutler Lab
Gene Symbol Pbrm1
Ensembl Gene ENSMUSG00000042323
Gene Namepolybromo 1
SynonymsBAF180, Pb1, 2610016F04Rik, 2310032M22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7216 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location31019138-31121592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31045422 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 331 (Y331C)
Ref Sequence ENSEMBL: ENSMUSP00000107727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022471] [ENSMUST00000022474] [ENSMUST00000052239] [ENSMUST00000090214] [ENSMUST00000112092] [ENSMUST00000112094] [ENSMUST00000112095] [ENSMUST00000112098] [ENSMUST00000123678] [ENSMUST00000135704] [ENSMUST00000136237] [ENSMUST00000146325] [ENSMUST00000156628]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022471
AA Change: Y331C

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022471
Gene: ENSMUSG00000042323
AA Change: Y331C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1450 8.91e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000022474
AA Change: Y331C

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022474
Gene: ENSMUSG00000042323
AA Change: Y331C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1465 8.91e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000052239
AA Change: Y331C

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060476
Gene: ENSMUSG00000042323
AA Change: Y331C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1049 8.64e-22 SMART
low complexity region 1058 1072 N/A INTRINSIC
BAH 1131 1247 3.02e-35 SMART
low complexity region 1293 1310 N/A INTRINSIC
HMG 1326 1396 2.87e-13 SMART
low complexity region 1405 1430 N/A INTRINSIC
low complexity region 1449 1477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090214
AA Change: Y331C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087682
Gene: ENSMUSG00000042323
AA Change: Y331C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 1.62e-21 SMART
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 1485 1500 N/A INTRINSIC
low complexity region 1512 1537 N/A INTRINSIC
low complexity region 1556 1584 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112092
AA Change: Y331C

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107721
Gene: ENSMUSG00000042323
AA Change: Y331C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1519 1547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112094
SMART Domains Protein: ENSMUSP00000107723
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 322 338 N/A INTRINSIC
BROMO 347 457 1.57e-32 SMART
BROMO 484 595 6.07e-39 SMART
BROMO 619 733 3.01e-43 SMART
BROMO 743 849 2.53e-18 SMART
coiled coil region 875 902 N/A INTRINSIC
BAH 924 1042 1.33e-45 SMART
low complexity region 1051 1065 N/A INTRINSIC
BAH 1124 1240 3.02e-35 SMART
low complexity region 1286 1306 N/A INTRINSIC
HMG 1346 1416 2.87e-13 SMART
low complexity region 1425 1450 N/A INTRINSIC
low complexity region 1469 1497 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112095
AA Change: Y331C

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107724
Gene: ENSMUSG00000042323
AA Change: Y331C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 2.87e-13 SMART
low complexity region 1457 1482 N/A INTRINSIC
low complexity region 1501 1529 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112098
AA Change: Y331C

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107727
Gene: ENSMUSG00000042323
AA Change: Y331C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1500 1515 N/A INTRINSIC
low complexity region 1527 1552 N/A INTRINSIC
low complexity region 1571 1599 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123678
AA Change: Y331C

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120549
Gene: ENSMUSG00000042323
AA Change: Y331C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 856 2.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135704
AA Change: Y275C

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115505
Gene: ENSMUSG00000042323
AA Change: Y275C

DomainStartEndE-ValueType
BROMO 1 97 3.24e-25 SMART
BROMO 119 233 5.84e-41 SMART
low complexity region 298 314 N/A INTRINSIC
BROMO 323 433 1.57e-32 SMART
BROMO 475 586 6.07e-39 SMART
BROMO 610 724 3.01e-43 SMART
BROMO 734 840 2.53e-18 SMART
low complexity region 862 892 N/A INTRINSIC
BAH 914 1032 1.33e-45 SMART
low complexity region 1041 1055 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136237
AA Change: Y331C

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119722
Gene: ENSMUSG00000042323
AA Change: Y331C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 859 7.08e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146325
SMART Domains Protein: ENSMUSP00000122805
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 64 174 4.97e-35 SMART
BROMO 196 310 5.84e-41 SMART
low complexity region 343 359 N/A INTRINSIC
BROMO 368 478 1.57e-32 SMART
BROMO 505 616 6.07e-39 SMART
BROMO 640 754 3.01e-43 SMART
BROMO 764 870 2.53e-18 SMART
coiled coil region 896 923 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156628
AA Change: Y331C

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123546
Gene: ENSMUSG00000042323
AA Change: Y331C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
low complexity region 903 933 N/A INTRINSIC
BAH 955 1073 1.33e-45 SMART
low complexity region 1082 1096 N/A INTRINSIC
BAH 1155 1271 3.02e-35 SMART
low complexity region 1317 1337 N/A INTRINSIC
HMG 1377 1447 2.87e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a subunit of ATP-dependent chromatin-remodeling complexes. The encoded protein has been identified as in integral component of complexes necessary for ligand-dependent transcriptional activation by nuclear hormone receptors. Mutations at this locus have been associated with primary clear cell renal cell carcinoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality with hypoplastic cardiac ventricular chambers and malformation of the placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T A 12: 53,140,457 N1551K probably benign Het
Amy2a1 T C 3: 113,530,441 D150G possibly damaging Het
Atp2b1 T A 10: 98,986,977 C165S probably benign Het
Atp2c1 A T 9: 105,467,731 D102E probably benign Het
Capn8 C A 1: 182,598,798 R233S possibly damaging Het
Cd48 T C 1: 171,695,822 S78P probably damaging Het
Clasp1 T A 1: 118,547,918 D944E probably benign Het
Clip2 A G 5: 134,502,917 M678T probably benign Het
Clmp T C 9: 40,760,909 Y12H possibly damaging Het
Col22a1 A T 15: 71,973,845 V356D probably damaging Het
Copg2 A T 6: 30,885,600 D101E probably damaging Het
Cpsf6 G A 10: 117,362,023 P229S unknown Het
Dgke T C 11: 89,050,337 D340G probably benign Het
Dlg1 TAAA TAA 16: 31,796,918 probably null Het
Dlg5 G A 14: 24,136,638 Q1865* probably null Het
Dnajc2 C T 5: 21,776,779 R123Q probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Egln2 T C 7: 27,159,829 D365G probably damaging Het
Epha4 T C 1: 77,444,984 D287G probably damaging Het
Fat4 A G 3: 38,891,043 T1362A probably damaging Het
Flt4 A G 11: 49,634,681 T685A possibly damaging Het
Fras1 T C 5: 96,739,314 Y2652H probably damaging Het
Gas2 A G 7: 51,897,257 E52G possibly damaging Het
Gm11639 A T 11: 104,880,549 K2633N possibly damaging Het
Gm13103 A G 4: 143,851,829 I220V probably damaging Het
Gm5093 A T 17: 46,440,088 D4E not run Het
Gm6370 A T 5: 146,493,913 T303S probably benign Het
Gpr161 A G 1: 165,306,546 I126V probably benign Het
Gpr63 T C 4: 25,008,038 L254P probably damaging Het
H2-M9 C T 17: 36,640,702 V294I probably benign Het
Insr T A 8: 3,203,034 N375I possibly damaging Het
Ints1 T C 5: 139,768,984 N600S possibly damaging Het
Ints10 A G 8: 68,822,157 N628S probably damaging Het
Irf2 A G 8: 46,793,556 T20A probably benign Het
Irs1 T A 1: 82,289,755 T247S probably damaging Het
Islr C T 9: 58,156,967 S419N unknown Het
Kcna2 T A 3: 107,104,793 I230N probably damaging Het
Kif3c C A 12: 3,366,126 A49E probably benign Het
Kifap3 A T 1: 163,795,989 K108N probably damaging Het
Lama3 T A 18: 12,430,000 F527I probably damaging Het
Layn A G 9: 51,077,052 probably benign Het
Lims2 G T 18: 31,957,262 W276L probably damaging Het
Lsp1 T C 7: 142,488,442 L133S probably damaging Het
Map3k6 T G 4: 133,246,900 V536G probably damaging Het
Med7 T A 11: 46,440,854 L92H probably damaging Het
Mllt1 A G 17: 56,927,042 V48A probably damaging Het
Mpp5 G A 12: 78,797,232 R70H probably damaging Het
Neurl4 T A 11: 69,910,262 V1153E probably damaging Het
Nkx2-1 A C 12: 56,534,802 C87G probably damaging Het
Nsun7 T C 5: 66,278,657 S291P probably damaging Het
Olfr148 A T 9: 39,614,494 Q309L probably benign Het
Olfr1508 G A 14: 52,463,488 P174S probably damaging Het
Olfr406 A T 11: 74,269,724 I112F probably damaging Het
Olfr46 A T 7: 140,610,460 N90I possibly damaging Het
Olfr829 T A 9: 18,857,336 M237K probably benign Het
Pirb T A 7: 3,716,274 T539S probably benign Het
Plch2 T G 4: 154,984,228 T1314P probably benign Het
Polk T C 13: 96,508,220 S133G probably benign Het
Prdm5 A T 6: 65,927,983 K533* probably null Het
Prmt1 T A 7: 44,983,573 Q35H probably benign Het
Pum3 A T 19: 27,424,225 W142R probably damaging Het
Rest G A 5: 77,282,608 R958H probably benign Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Ripor2 G A 13: 24,671,903 G109R probably damaging Het
Sec62 C T 3: 30,818,829 Q354* probably null Het
Snx14 T C 9: 88,381,791 Y847C probably damaging Het
Soga1 T C 2: 157,018,370 R1650G possibly damaging Het
Sox7 A T 14: 63,947,989 D158V probably benign Het
Spag8 A G 4: 43,652,034 V350A possibly damaging Het
Syngr1 A T 15: 80,111,733 I158F probably damaging Het
Tacstd2 C A 6: 67,534,995 V238L probably benign Het
Tex15 T C 8: 33,572,986 S815P possibly damaging Het
Tmem117 A T 15: 94,714,912 T110S possibly damaging Het
Tnrc6a T C 7: 123,171,495 I836T probably benign Het
Trim30b C A 7: 104,357,362 V96L probably benign Het
Tssk3 TGCTATCATGGGG TG 4: 129,489,313 probably null Het
Tyk2 G T 9: 21,120,526 H418N probably benign Het
Uap1 G T 1: 170,158,903 T170K probably damaging Het
Vmn1r40 T C 6: 89,714,624 V141A not run Het
Vmn1r54 T A 6: 90,269,665 I187K probably damaging Het
Vmp1 C T 11: 86,602,033 V317M probably damaging Het
Wnt8b A G 19: 44,512,072 K366R probably benign Het
Zfp207 C T 11: 80,395,178 P415L unknown Het
Zfp263 A G 16: 3,744,571 E66G probably damaging Het
Zfp985 T A 4: 147,583,456 H260Q probably damaging Het
Zmiz1 GCC GC 14: 25,576,200 probably null Het
Zmiz1 A C 14: 25,576,207 Q46P probably damaging Het
Zmiz1 A G 14: 25,576,209 R47G probably damaging Het
Other mutations in Pbrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Pbrm1 APN 14 31030927 missense probably damaging 1.00
IGL00648:Pbrm1 APN 14 31052283 missense probably damaging 1.00
IGL00654:Pbrm1 APN 14 31032404 splice site probably benign
IGL00674:Pbrm1 APN 14 31118776 missense probably damaging 1.00
IGL00701:Pbrm1 APN 14 31052248 missense probably damaging 1.00
IGL00850:Pbrm1 APN 14 31087619 missense probably damaging 1.00
IGL01024:Pbrm1 APN 14 31052260 missense probably damaging 1.00
IGL01924:Pbrm1 APN 14 31082604 missense probably damaging 1.00
IGL02122:Pbrm1 APN 14 31089616 missense probably damaging 0.97
IGL02390:Pbrm1 APN 14 31032510 missense probably benign 0.00
IGL02675:Pbrm1 APN 14 31106287 missense possibly damaging 0.85
IGL02936:Pbrm1 APN 14 31061513 missense probably damaging 1.00
IGL02938:Pbrm1 APN 14 31067804 missense probably damaging 1.00
IGL02997:Pbrm1 APN 14 31061551 missense probably damaging 1.00
IGL03246:Pbrm1 APN 14 31110549 missense probably benign 0.00
IGL03290:Pbrm1 APN 14 31107284 missense probably damaging 1.00
IGL03372:Pbrm1 APN 14 31085019 missense probably benign 0.04
IGL03386:Pbrm1 APN 14 31050092 missense probably damaging 1.00
PIT4520001:Pbrm1 UTSW 14 31067861 missense probably damaging 0.99
R0502:Pbrm1 UTSW 14 31064820 missense probably benign 0.36
R0552:Pbrm1 UTSW 14 31035959 missense probably damaging 1.00
R0558:Pbrm1 UTSW 14 31085059 splice site probably null
R0561:Pbrm1 UTSW 14 31035991 missense probably benign
R0591:Pbrm1 UTSW 14 31046430 splice site probably benign
R0835:Pbrm1 UTSW 14 31067579 missense probably damaging 1.00
R1167:Pbrm1 UTSW 14 31050142 missense probably damaging 1.00
R1209:Pbrm1 UTSW 14 31118852 missense probably damaging 1.00
R1259:Pbrm1 UTSW 14 31074814 missense probably damaging 1.00
R1321:Pbrm1 UTSW 14 31067502 missense probably damaging 1.00
R1622:Pbrm1 UTSW 14 31032548 missense probably benign 0.07
R1843:Pbrm1 UTSW 14 31038957 missense probably damaging 1.00
R1870:Pbrm1 UTSW 14 31106175 missense probably damaging 0.99
R2202:Pbrm1 UTSW 14 31032449 missense possibly damaging 0.76
R2203:Pbrm1 UTSW 14 31032449 missense possibly damaging 0.76
R2247:Pbrm1 UTSW 14 31074893 missense probably damaging 1.00
R3237:Pbrm1 UTSW 14 31032475 missense probably damaging 1.00
R4091:Pbrm1 UTSW 14 31036003 missense probably benign 0.00
R4280:Pbrm1 UTSW 14 31107312 critical splice donor site probably null
R4379:Pbrm1 UTSW 14 31067706 missense probably damaging 1.00
R4381:Pbrm1 UTSW 14 31025556 missense probably benign 0.02
R4816:Pbrm1 UTSW 14 31110448 missense probably benign 0.32
R4939:Pbrm1 UTSW 14 31061623 missense probably damaging 1.00
R4945:Pbrm1 UTSW 14 31052216 missense probably damaging 0.97
R4958:Pbrm1 UTSW 14 31074827 missense probably damaging 1.00
R5095:Pbrm1 UTSW 14 31032530 missense probably benign 0.00
R5276:Pbrm1 UTSW 14 31106184 missense probably damaging 0.99
R5387:Pbrm1 UTSW 14 31082610 missense probably damaging 1.00
R5434:Pbrm1 UTSW 14 31085011 missense probably damaging 0.96
R5476:Pbrm1 UTSW 14 31032519 missense probably benign 0.00
R5522:Pbrm1 UTSW 14 31089563 missense probably damaging 1.00
R5548:Pbrm1 UTSW 14 31105424 missense probably damaging 1.00
R5605:Pbrm1 UTSW 14 31035992 missense probably benign 0.20
R6089:Pbrm1 UTSW 14 31087585 missense probably damaging 0.99
R6159:Pbrm1 UTSW 14 31052283 missense possibly damaging 0.95
R6224:Pbrm1 UTSW 14 31050111 missense probably benign 0.19
R6335:Pbrm1 UTSW 14 31084095 missense probably damaging 1.00
R6499:Pbrm1 UTSW 14 31061509 missense probably damaging 0.99
R6823:Pbrm1 UTSW 14 31084790 missense probably damaging 1.00
R7002:Pbrm1 UTSW 14 31064820 missense probably benign 0.36
R7021:Pbrm1 UTSW 14 31067816 missense probably damaging 0.98
R7588:Pbrm1 UTSW 14 31084943 missense probably damaging 0.99
R7828:Pbrm1 UTSW 14 31030891 missense probably damaging 1.00
R8035:Pbrm1 UTSW 14 31084152 missense probably damaging 1.00
R8188:Pbrm1 UTSW 14 31067816 missense probably damaging 0.98
R8417:Pbrm1 UTSW 14 31027462 missense possibly damaging 0.92
R8517:Pbrm1 UTSW 14 31067782 missense probably benign 0.00
Z1088:Pbrm1 UTSW 14 31110454 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTTGACACAGAACTTGCTGC -3'
(R):5'- AGAACCTTAACTTACGTGTGGTTAC -3'

Sequencing Primer
(F):5'- CTTGCTGCATAATAGAAGCTCAG -3'
(R):5'- GCTATATAACCCAGACTGGCCTTG -3'
Posted On2019-06-26