Incidental Mutation 'R7275:Acsm5'
ID565516
Institutional Source Beutler Lab
Gene Symbol Acsm5
Ensembl Gene ENSMUSG00000030972
Gene Nameacyl-CoA synthetase medium-chain family member 5
SynonymsC730027J19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R7275 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location119519463-119545551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119537288 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 361 (T361A)
Ref Sequence ENSEMBL: ENSMUSP00000063416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066465] [ENSMUST00000207307] [ENSMUST00000207381] [ENSMUST00000207387] [ENSMUST00000207440] [ENSMUST00000207796] [ENSMUST00000207813]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066465
AA Change: T361A

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063416
Gene: ENSMUSG00000030972
AA Change: T361A

DomainStartEndE-ValueType
low complexity region 26 32 N/A INTRINSIC
Pfam:AMP-binding 65 477 2.9e-78 PFAM
Pfam:AMP-binding_C 485 565 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207307
Predicted Effect probably benign
Transcript: ENSMUST00000207381
Predicted Effect probably benign
Transcript: ENSMUST00000207387
Predicted Effect possibly damaging
Transcript: ENSMUST00000207440
AA Change: T361A

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207796
AA Change: T361A

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000207813
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T A 12: 72,910,021 T132S possibly damaging Het
4933412E24Rik A G 15: 60,015,889 V234A probably benign Het
Agxt2 G A 15: 10,358,667 R24H probably benign Het
Asb16 G T 11: 102,269,109 W96L probably damaging Het
BC037034 T C 5: 138,263,577 S86G probably benign Het
Bche T A 3: 73,700,636 T486S probably benign Het
Btbd11 T A 10: 85,654,482 L1004Q probably damaging Het
Cast T C 13: 74,727,334 T382A probably benign Het
Cdcp1 T A 9: 123,185,054 K218N possibly damaging Het
Ceacam18 G A 7: 43,641,884 G250D probably damaging Het
Ctnnd2 T C 15: 30,905,709 I834T possibly damaging Het
Cyp11b2 C A 15: 74,853,991 G136W probably damaging Het
Dis3 A G 14: 99,087,489 V502A probably damaging Het
Dnaic2 T A 11: 114,757,228 M610K unknown Het
Drosha G A 15: 12,846,083 V435I possibly damaging Het
Dsc2 T A 18: 20,051,179 R51* probably null Het
Ergic2 A T 6: 148,195,259 C170S probably damaging Het
Exoc7 A T 11: 116,304,862 probably null Het
Fbxw25 G T 9: 109,654,592 A184E Het
Gm4846 T A 1: 166,487,079 T332S probably benign Het
Gm5152 T C 5: 10,245,225 N71D Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grik1 T C 16: 87,912,820 N871S probably benign Het
Il11ra1 T C 4: 41,765,109 L145P probably damaging Het
Impad1 C A 4: 4,792,962 G48W probably damaging Het
Inpp5e A G 2: 26,408,092 S166P probably benign Het
Kdm4b T A 17: 56,396,333 L676H probably damaging Het
Lrp2 T A 2: 69,459,531 K3655* probably null Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Map3k14 T C 11: 103,227,022 E648G probably damaging Het
Mbtps1 A T 8: 119,542,750 D200E probably benign Het
Mttp T C 3: 138,123,785 D114G probably benign Het
Mup13 G A 4: 61,226,753 T101M probably benign Het
Narfl T A 17: 25,775,134 V52E possibly damaging Het
Neb T A 2: 52,206,944 T4953S probably benign Het
Nfasc A C 1: 132,634,263 L147R probably damaging Het
Obox6 T C 7: 15,833,880 E214G probably benign Het
Olfr1054 C A 2: 86,332,792 C188F possibly damaging Het
Olfr340 A T 2: 36,452,839 M85L probably benign Het
Olfr936 T A 9: 39,047,519 probably benign Het
Opn3 T C 1: 175,665,473 N175S probably damaging Het
Osbpl3 G T 6: 50,346,430 D224E probably benign Het
Osr2 A G 15: 35,300,886 D196G probably damaging Het
Pde8b T A 13: 95,042,934 N405Y probably damaging Het
Pirb A G 7: 3,716,178 S571P probably benign Het
Psmc3 T A 2: 91,055,930 I163N probably damaging Het
Rapgef4 A G 2: 72,208,101 D532G probably damaging Het
Retreg1 A G 15: 25,971,598 D208G probably benign Het
Rgsl1 T G 1: 153,804,130 probably null Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Slc30a2 T A 4: 134,349,270 probably null Het
Slc6a19 T C 13: 73,686,078 D335G probably benign Het
Slco4c1 G A 1: 96,871,772 T113M probably benign Het
Stxbp6 A G 12: 44,902,003 F108L probably benign Het
Sulf1 T A 1: 12,850,965 probably null Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tbc1d19 T A 5: 53,872,276 D326E probably damaging Het
Tcrg-V3 A G 13: 19,243,018 T24A probably benign Het
Trpm3 T A 19: 22,978,684 M1170K possibly damaging Het
Tubgcp6 G A 15: 89,102,943 Q1276* probably null Het
Tyrp1 A G 4: 80,837,584 K197E possibly damaging Het
Ube2cbp T C 9: 86,440,626 D165G probably damaging Het
Zfp212 A G 6: 47,920,744 T7A probably benign Het
Zhx1 T C 15: 58,054,362 T163A probably benign Het
Zp2 A T 7: 120,135,353 probably null Het
Other mutations in Acsm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Acsm5 APN 7 119542438 critical splice donor site probably null
IGL01662:Acsm5 APN 7 119538288 missense probably damaging 1.00
IGL02228:Acsm5 APN 7 119531866 missense probably damaging 1.00
IGL02380:Acsm5 APN 7 119537286 missense probably benign 0.05
IGL02709:Acsm5 APN 7 119534818 nonsense probably null
P4717OSA:Acsm5 UTSW 7 119531972 missense probably benign 0.12
R0506:Acsm5 UTSW 7 119538096 nonsense probably null
R0518:Acsm5 UTSW 7 119535800 missense possibly damaging 0.95
R0866:Acsm5 UTSW 7 119540900 missense probably damaging 0.99
R1171:Acsm5 UTSW 7 119540852 missense probably damaging 0.99
R2362:Acsm5 UTSW 7 119528426 start gained probably benign
R2511:Acsm5 UTSW 7 119530454 missense possibly damaging 0.80
R4670:Acsm5 UTSW 7 119531760 splice site probably null
R4908:Acsm5 UTSW 7 119538091 missense probably damaging 1.00
R4913:Acsm5 UTSW 7 119534343 missense probably damaging 0.98
R5038:Acsm5 UTSW 7 119534811 missense probably damaging 1.00
R5112:Acsm5 UTSW 7 119537279 missense possibly damaging 0.95
R6337:Acsm5 UTSW 7 119534235 missense probably benign 0.00
R6481:Acsm5 UTSW 7 119534881 missense probably benign 0.02
R7268:Acsm5 UTSW 7 119537288 missense probably benign 0.38
R7509:Acsm5 UTSW 7 119534388 missense probably benign
R8021:Acsm5 UTSW 7 119542393 missense possibly damaging 0.72
Z1088:Acsm5 UTSW 7 119537211 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCACATGGAGTTGACTGTGG -3'
(R):5'- GCATTCCCTACCAGTTTCAGTG -3'

Sequencing Primer
(F):5'- CTAGTGACTTAAGAGCTCTGGACC -3'
(R):5'- ACCAGTTTCAGTGCCCTAGAG -3'
Posted On2019-06-26