Incidental Mutation 'R7290:Tmem94'
ID 566344
Institutional Source Beutler Lab
Gene Symbol Tmem94
Ensembl Gene ENSMUSG00000020747
Gene Name transmembrane protein 94
Synonyms 2310067B10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock # R7290 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 115765433-115799366 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 115786256 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 118 (R118L)
Ref Sequence ENSEMBL: ENSMUSP00000091440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093912] [ENSMUST00000103033] [ENSMUST00000103034] [ENSMUST00000125918] [ENSMUST00000136720] [ENSMUST00000141871]
AlphaFold Q7TSH8
Predicted Effect possibly damaging
Transcript: ENSMUST00000093912
AA Change: R118L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747
AA Change: R118L

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103033
AA Change: R118L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747
AA Change: R118L

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000103034
AA Change: R74L
SMART Domains Protein: ENSMUSP00000099323
Gene: ENSMUSG00000020747
AA Change: R74L

DomainStartEndE-ValueType
transmembrane domain 52 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125918
SMART Domains Protein: ENSMUSP00000116666
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 105 115 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136720
SMART Domains Protein: ENSMUSP00000122111
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 72 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141871
SMART Domains Protein: ENSMUSP00000118396
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 72 84 N/A INTRINSIC
Meta Mutation Damage Score 0.3043 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 110,030,888 M1447L probably benign Het
Adam30 G A 3: 98,162,941 V697I probably benign Het
Adamts12 A G 15: 11,277,366 N689D probably benign Het
Adamts15 T C 9: 30,902,610 K753R probably benign Het
Adra2a T C 19: 54,046,404 F64L probably damaging Het
Ankub1 A G 3: 57,672,924 L104P probably damaging Het
Arel1 A G 12: 84,941,945 V10A probably benign Het
Atad2 A T 15: 58,098,651 N1165K probably benign Het
Atp6v0d2 T A 4: 19,880,060 D279V probably benign Het
Cadps A T 14: 12,616,099 D310E probably damaging Het
Caskin2 T C 11: 115,804,789 I249V possibly damaging Het
Cdh23 T C 10: 60,376,841 N1598S probably benign Het
Cep250 A T 2: 155,992,762 Q2202H probably benign Het
Ces5a T A 8: 93,534,683 T35S probably damaging Het
Cnot11 G A 1: 39,539,939 W295* probably null Het
Cntnap5a G T 1: 116,221,889 W565L probably damaging Het
Dgka T C 10: 128,733,599 E148G probably damaging Het
Dnah14 G A 1: 181,628,174 D955N probably benign Het
Erbin G A 13: 103,862,326 T184I probably damaging Het
Fam208a T A 14: 27,438,653 I124N probably damaging Het
Fam20c G T 5: 138,807,554 G477W probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgfr4 T C 13: 55,161,449 V433A probably benign Het
Gal3st1 A T 11: 3,998,093 Q100L possibly damaging Het
Gfra2 T C 14: 70,925,940 F221S probably damaging Het
Gm19965 G A 1: 116,821,191 V201M Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Gnb1l A T 16: 18,564,056 T282S probably benign Het
Gpr171 A T 3: 59,097,726 N209K probably benign Het
Grasp G A 15: 101,231,538 S234N probably damaging Het
Greb1 G A 12: 16,711,738 T547I probably damaging Het
Ifi214 A T 1: 173,529,531 V2E probably benign Het
Ighv1-71 T C 12: 115,742,647 M1V probably null Het
Itm2b C T 14: 73,368,345 G67D probably damaging Het
Kif21a A T 15: 90,967,229 C995* probably null Het
Kifc2 A T 15: 76,660,704 Y13F probably damaging Het
Lamb1 T A 12: 31,265,596 V59D probably benign Het
Lhx1 A T 11: 84,521,877 D163E probably damaging Het
Lrrc1 A T 9: 77,457,839 Y187N probably benign Het
Map3k1 C A 13: 111,768,111 V380F probably damaging Het
Mapk11 T C 15: 89,144,308 D283G probably damaging Het
Mccc2 G T 13: 99,954,699 A430D probably damaging Het
Mest A G 6: 30,747,159 N340S unknown Het
Mms22l T C 4: 24,517,139 L340P probably benign Het
Mrnip A G 11: 50,196,981 Y110C possibly damaging Het
Mtmr4 A G 11: 87,611,237 T706A probably benign Het
Ncstn A G 1: 172,072,806 F234S probably benign Het
Nrp1 T C 8: 128,476,296 probably null Het
Nup37 T G 10: 88,174,494 C217G probably damaging Het
Olfr936 A G 9: 39,047,398 L7P unknown Het
Pdzrn3 T C 6: 101,151,245 N820S probably benign Het
Pgap1 A T 1: 54,548,066 F117Y possibly damaging Het
Phip A T 9: 82,871,293 F1799L possibly damaging Het
Ppm1f T A 16: 16,910,955 F74I probably benign Het
Prpf8 C A 11: 75,493,957 N775K possibly damaging Het
Ptdss2 T C 7: 141,151,780 I167T possibly damaging Het
Ptpn18 G A 1: 34,462,811 probably null Het
Rbl2 C A 8: 91,115,041 A955D probably benign Het
Rgl1 A G 1: 152,544,395 S366P possibly damaging Het
Rit2 A T 18: 31,243,168 M38K possibly damaging Het
Robo1 A G 16: 73,004,520 M1011V probably benign Het
Senp6 A T 9: 80,136,515 E809D probably benign Het
Stard3 G A 11: 98,378,219 probably null Het
Taar3 T G 10: 23,950,400 Y281* probably null Het
Tacc2 G T 7: 130,729,373 K352N probably benign Het
Tdpoz4 G A 3: 93,796,848 V151I not run Het
Tenm2 A G 11: 36,023,471 L2413P probably damaging Het
Tgm6 T C 2: 130,141,190 V233A probably damaging Het
Tlx3 G A 11: 33,203,514 probably benign Het
Trim23 C A 13: 104,187,433 H133Q probably damaging Het
Unc80 A T 1: 66,601,197 D1421V probably damaging Het
Vmn1r172 A G 7: 23,660,623 N311S unknown Het
Vps25 T A 11: 101,258,949 L153Q probably damaging Het
Wbp1l G T 19: 46,623,437 probably benign Het
Ythdc2 A G 18: 44,837,491 I291V possibly damaging Het
Zfp2 A G 11: 50,900,743 C158R probably damaging Het
Zfp786 G A 6: 47,819,995 P670S probably damaging Het
Zfp827 G A 8: 79,189,813 R339H possibly damaging Het
Zmym6 C T 4: 127,123,501 A1025V possibly damaging Het
Other mutations in Tmem94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Tmem94 APN 11 115795328 missense probably damaging 0.99
IGL01086:Tmem94 APN 11 115790284 missense probably benign 0.25
IGL01314:Tmem94 APN 11 115790009 missense probably damaging 0.99
IGL02123:Tmem94 APN 11 115787538 missense possibly damaging 0.51
IGL02355:Tmem94 APN 11 115794745 missense probably damaging 1.00
IGL02362:Tmem94 APN 11 115794745 missense probably damaging 1.00
IGL02366:Tmem94 APN 11 115797432 missense probably damaging 0.98
IGL02450:Tmem94 APN 11 115793071 missense probably damaging 1.00
IGL02623:Tmem94 APN 11 115796401 nonsense probably null
IGL02816:Tmem94 APN 11 115788704 splice site probably null
IGL02836:Tmem94 APN 11 115792939 missense probably damaging 1.00
IGL03061:Tmem94 APN 11 115792421 missense possibly damaging 0.94
IGL03109:Tmem94 APN 11 115792398 missense probably damaging 1.00
IGL03255:Tmem94 APN 11 115792068 unclassified probably benign
IGL03397:Tmem94 APN 11 115787568 unclassified probably benign
capitulate UTSW 11 115796746 missense probably damaging 1.00
R0083:Tmem94 UTSW 11 115796724 unclassified probably benign
R0336:Tmem94 UTSW 11 115787385 missense probably benign
R0370:Tmem94 UTSW 11 115788717 missense probably damaging 1.00
R0494:Tmem94 UTSW 11 115794781 splice site probably null
R0638:Tmem94 UTSW 11 115792060 splice site probably null
R0647:Tmem94 UTSW 11 115796795 missense probably damaging 1.00
R0900:Tmem94 UTSW 11 115791978 missense probably benign 0.00
R1469:Tmem94 UTSW 11 115795091 unclassified probably benign
R1616:Tmem94 UTSW 11 115796145 critical splice donor site probably null
R1621:Tmem94 UTSW 11 115785845 missense probably benign
R1682:Tmem94 UTSW 11 115790230 missense probably damaging 1.00
R1723:Tmem94 UTSW 11 115794748 missense probably damaging 1.00
R1760:Tmem94 UTSW 11 115796754 missense probably damaging 1.00
R1826:Tmem94 UTSW 11 115793213 nonsense probably null
R1926:Tmem94 UTSW 11 115792900 missense possibly damaging 0.67
R1956:Tmem94 UTSW 11 115788674 missense possibly damaging 0.75
R2033:Tmem94 UTSW 11 115794328 missense possibly damaging 0.65
R2135:Tmem94 UTSW 11 115794749 missense probably benign
R2419:Tmem94 UTSW 11 115796815 missense probably damaging 1.00
R2511:Tmem94 UTSW 11 115791961 missense probably damaging 1.00
R3932:Tmem94 UTSW 11 115789254 missense probably benign 0.00
R4708:Tmem94 UTSW 11 115786295 missense possibly damaging 0.87
R4812:Tmem94 UTSW 11 115796112 nonsense probably null
R5026:Tmem94 UTSW 11 115793104 missense probably damaging 1.00
R5714:Tmem94 UTSW 11 115793190 missense probably benign 0.04
R5716:Tmem94 UTSW 11 115792428 missense probably benign 0.17
R6180:Tmem94 UTSW 11 115791031 critical splice acceptor site probably null
R6295:Tmem94 UTSW 11 115796746 missense probably damaging 1.00
R6594:Tmem94 UTSW 11 115798286 missense probably damaging 1.00
R6696:Tmem94 UTSW 11 115791988 missense probably damaging 1.00
R6883:Tmem94 UTSW 11 115796461 missense probably damaging 1.00
R6939:Tmem94 UTSW 11 115785830 missense possibly damaging 0.47
R7060:Tmem94 UTSW 11 115792938 missense probably damaging 1.00
R7171:Tmem94 UTSW 11 115790955 splice site probably null
R7181:Tmem94 UTSW 11 115794774 missense probably damaging 0.97
R7292:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7345:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7346:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7378:Tmem94 UTSW 11 115794174 missense probably damaging 1.00
R7380:Tmem94 UTSW 11 115796145 critical splice donor site probably null
R7460:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7461:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7463:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7464:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7465:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7673:Tmem94 UTSW 11 115788378 missense probably benign 0.05
R7995:Tmem94 UTSW 11 115797971 missense probably damaging 1.00
R8094:Tmem94 UTSW 11 115788392 critical splice donor site probably null
R8447:Tmem94 UTSW 11 115797197 missense possibly damaging 0.93
R8447:Tmem94 UTSW 11 115797870 missense probably benign
R8825:Tmem94 UTSW 11 115797375 missense probably benign 0.00
R8910:Tmem94 UTSW 11 115797426 missense probably damaging 1.00
R9226:Tmem94 UTSW 11 115792365 missense probably damaging 1.00
RF003:Tmem94 UTSW 11 115796132 missense probably damaging 1.00
X0024:Tmem94 UTSW 11 115786253 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCTGAGGAGCTGTAGTGACC -3'
(R):5'- CCAGTACCAGTGGACAAGACAG -3'

Sequencing Primer
(F):5'- CTGTAGTGACCCGAGCATAG -3'
(R):5'- GGGGGTAAAAACTCTCAACTTCC -3'
Posted On 2019-06-26