Incidental Mutation 'R7493:Ppp3cb'
ID580956
Institutional Source Beutler Lab
Gene Symbol Ppp3cb
Ensembl Gene ENSMUSG00000021816
Gene Nameprotein phosphatase 3, catalytic subunit, beta isoform
SynonymsCalnb, PP2BA beta, Cnab, CnAbeta, 1110063J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7493 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location20499364-20546573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20508551 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 481 (H481L)
Ref Sequence ENSEMBL: ENSMUSP00000125582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022355] [ENSMUST00000159027] [ENSMUST00000161445] [ENSMUST00000161989]
Predicted Effect probably benign
Transcript: ENSMUST00000022355
SMART Domains Protein: ENSMUSP00000022355
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159027
SMART Domains Protein: ENSMUSP00000125722
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161445
SMART Domains Protein: ENSMUSP00000125630
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161989
AA Change: H481L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125582
Gene: ENSMUSG00000021816
AA Change: H481L

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
low complexity region 487 497 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (74/76)
MGI Phenotype PHENOTYPE: Homozygous null mice have small hearts and thymi, and reduced body weight. Cardiac function is normal, but mice lack a cardiac hypertrophic response to pressure overload, angiotensin II, or isopreteronol. Thymi are hypoplastic, with abnormal T cell development and reduced numbers of T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,531 D122G probably benign Het
3110062M04Rik A T 6: 34,874,658 L114Q probably damaging Het
3425401B19Rik A G 14: 32,663,300 L236P possibly damaging Het
4932415D10Rik A T 10: 82,288,964 Y2737* probably null Het
4932415D10Rik T C 10: 82,316,430 Y34C unknown Het
9030624J02Rik C T 7: 118,794,577 probably null Het
Abca7 T A 10: 80,002,062 D488E probably damaging Het
Adora2a A G 10: 75,333,589 K296E possibly damaging Het
Atp13a4 T A 16: 29,471,956 E225V Het
Bpifb2 A G 2: 153,889,477 M258V possibly damaging Het
Brd2 G A 17: 34,122,257 probably benign Het
Btaf1 G T 19: 37,009,605 V1700F probably damaging Het
C2cd3 A G 7: 100,427,226 I797V Het
Ccdc148 T G 2: 59,009,148 E71A probably damaging Het
Ccdc18 T A 5: 108,206,617 L1074* probably null Het
Ccne2 A G 4: 11,198,772 D215G probably damaging Het
Cers6 T A 2: 68,861,807 probably null Het
Copz1 A G 15: 103,296,544 E110G probably damaging Het
Cped1 A T 6: 22,215,513 D682V probably damaging Het
Crb1 A T 1: 139,237,030 C1180S probably damaging Het
Echdc3 A T 2: 6,189,557 L229Q probably damaging Het
Etfb C T 7: 43,454,576 P145L probably damaging Het
Exoc3l2 G T 7: 19,469,888 R135L Het
Fam83a G A 15: 57,986,173 A38T probably damaging Het
G6pc2 T C 2: 69,223,000 Y133H probably benign Het
Gfy T C 7: 45,178,094 I193V probably benign Het
Ggnbp2 T C 11: 84,854,073 T208A probably benign Het
Gigyf1 T A 5: 137,525,533 M1019K probably damaging Het
Gm15922 T C 7: 3,739,024 E119G not run Het
Gm45783 T C 7: 7,370,600 D61G probably damaging Het
Golga5 T C 12: 102,484,576 probably null Het
Ighe A G 12: 113,271,403 V379A Het
Itpr3 C A 17: 27,094,800 H573Q probably benign Het
Klhl2 A G 8: 64,749,775 L463P probably damaging Het
Large1 T G 8: 72,823,715 M619L probably benign Het
Limd1 T A 9: 123,479,683 V149E probably benign Het
Lyz2 T C 10: 117,282,239 K2E probably damaging Het
Man2c1 T A 9: 57,141,128 S858T probably damaging Het
Nt5dc1 A T 10: 34,304,936 N439K probably benign Het
Olfr1173 T C 2: 88,275,101 probably benign Het
Olfr1178 T C 2: 88,391,880 V211A possibly damaging Het
Olfr1239 A G 2: 89,417,801 I204T probably benign Het
Olfr566 A T 7: 102,857,071 Y70* probably null Het
Olfr733 G A 14: 50,298,824 L162F probably benign Het
Olfr845 A C 9: 19,338,813 M118L probably damaging Het
Otogl T C 10: 107,886,982 N296S probably benign Het
Patj A G 4: 98,495,061 N789D probably benign Het
Pcsk6 A G 7: 66,043,566 D851G possibly damaging Het
Peg3 T C 7: 6,709,724 H833R probably damaging Het
Plekha5 A G 6: 140,580,435 D933G probably benign Het
Pnma1 G A 12: 84,147,129 R267C probably damaging Het
Prl8a8 T C 13: 27,511,435 probably null Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptpro C A 6: 137,382,649 L406I probably benign Het
Rbpj T C 5: 53,600,934 S18P probably benign Het
Rhbg C T 3: 88,247,579 V173M probably damaging Het
Rps6kc1 A G 1: 190,800,057 S583P probably benign Het
Ryr1 T C 7: 29,095,205 S1217G probably benign Het
S1pr1 A T 3: 115,712,273 I224N probably damaging Het
Sall1 C T 8: 89,031,053 D808N probably benign Het
Shoc2 T C 19: 53,988,036 V119A probably benign Het
Ssh2 A T 11: 77,437,716 E369D probably benign Het
Stx1b C T 7: 127,807,359 V273M possibly damaging Het
Syne2 A G 12: 75,965,880 H2615R probably benign Het
Tmc8 T C 11: 117,784,932 I225T probably benign Het
Tmem126b A G 7: 90,472,646 I52T probably benign Het
Top2b G A 14: 16,416,605 D1122N probably benign Het
Trav13-2 T A 14: 53,634,906 S7T possibly damaging Het
Ttc1 A T 11: 43,745,362 L18Q probably damaging Het
Ttn A T 2: 76,737,209 I27780N probably damaging Het
Ubfd1 T C 7: 122,067,412 S44P probably benign Het
Vmn1r89 A G 7: 13,219,705 K123E probably damaging Het
Vmn2r62 A C 7: 42,787,892 F389L possibly damaging Het
Zdhhc11 T A 13: 73,973,607 M79K possibly damaging Het
Zfp202 G T 9: 40,207,344 V18F possibly damaging Het
Zfp39 A G 11: 58,891,043 F298L possibly damaging Het
Znrf1 G A 8: 111,537,439 G100D probably damaging Het
Other mutations in Ppp3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ppp3cb APN 14 20528250 missense probably benign 0.00
IGL00844:Ppp3cb APN 14 20531686 missense possibly damaging 0.95
IGL01859:Ppp3cb APN 14 20509449 missense probably damaging 0.99
IGL02490:Ppp3cb APN 14 20531658 critical splice donor site probably null
IGL02546:Ppp3cb APN 14 20501554 missense probably benign 0.00
IGL02555:Ppp3cb APN 14 20530953 missense probably damaging 1.00
IGL02724:Ppp3cb APN 14 20523577 splice site probably null
IGL02944:Ppp3cb APN 14 20528235 missense probably damaging 1.00
IGL03072:Ppp3cb APN 14 20531725 missense probably damaging 1.00
IGL03301:Ppp3cb APN 14 20523984 missense probably damaging 0.99
Copacabana UTSW 14 20530942 critical splice donor site probably null
eden_express UTSW 14 20528195 nonsense probably null
everglades UTSW 14 20530948 missense probably damaging 1.00
Havana UTSW 14 20531752 missense possibly damaging 0.85
justinian UTSW 14 20508543 missense possibly damaging 0.73
prokopios UTSW 14 20520652 missense probably benign 0.05
Redwood UTSW 14 20509440 missense probably damaging 1.00
R0026:Ppp3cb UTSW 14 20531768 missense probably benign 0.00
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.85
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.85
R0218:Ppp3cb UTSW 14 20523976 missense probably damaging 0.99
R0479:Ppp3cb UTSW 14 20503241 unclassified probably null
R1013:Ppp3cb UTSW 14 20524004 missense probably benign
R1061:Ppp3cb UTSW 14 20508614 splice site probably null
R1498:Ppp3cb UTSW 14 20509499 critical splice acceptor site probably null
R1508:Ppp3cb UTSW 14 20524424 missense probably damaging 0.99
R1719:Ppp3cb UTSW 14 20524063 missense probably benign 0.05
R1799:Ppp3cb UTSW 14 20524472 missense possibly damaging 0.81
R1883:Ppp3cb UTSW 14 20523845 missense possibly damaging 0.66
R2082:Ppp3cb UTSW 14 20508678 missense possibly damaging 0.66
R2176:Ppp3cb UTSW 14 20520652 missense probably benign 0.05
R3021:Ppp3cb UTSW 14 20523853 nonsense probably null
R3726:Ppp3cb UTSW 14 20530942 critical splice donor site probably null
R4085:Ppp3cb UTSW 14 20508543 missense possibly damaging 0.73
R4328:Ppp3cb UTSW 14 20530948 missense probably damaging 1.00
R4509:Ppp3cb UTSW 14 20515501 intron probably benign
R4600:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4601:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4603:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4610:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4611:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4694:Ppp3cb UTSW 14 20501515 missense probably benign 0.00
R4749:Ppp3cb UTSW 14 20524062 missense probably damaging 1.00
R4866:Ppp3cb UTSW 14 20523843 missense probably damaging 1.00
R4911:Ppp3cb UTSW 14 20509440 missense probably damaging 1.00
R5105:Ppp3cb UTSW 14 20509422 missense possibly damaging 0.84
R5219:Ppp3cb UTSW 14 20528195 nonsense probably null
R5586:Ppp3cb UTSW 14 20520690 splice site probably benign
R5740:Ppp3cb UTSW 14 20501596 missense possibly damaging 0.76
R6649:Ppp3cb UTSW 14 20531026 missense probably damaging 1.00
R7362:Ppp3cb UTSW 14 20523651 missense probably benign 0.00
Z1177:Ppp3cb UTSW 14 20508518 missense unknown
Predicted Primers PCR Primer
(F):5'- TCACATTCTTGACTGAGGCTTTTG -3'
(R):5'- TTCTCACTGTAGGGAGGAGAG -3'

Sequencing Primer
(F):5'- GGAATTATGACATGAGCTGCTCCC -3'
(R):5'- GTGAAAGCGTGCTGACACTC -3'
Posted On2019-10-17