Incidental Mutation 'R7493:Olfr733'
ID580958
Institutional Source Beutler Lab
Gene Symbol Olfr733
Ensembl Gene ENSMUSG00000090874
Gene Nameolfactory receptor 733
SynonymsMOR241-2, GA_x6K02T2PMLR-5992342-5991416
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R7493 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50295891-50301522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50298824 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 162 (L162F)
Ref Sequence ENSEMBL: ENSMUSP00000149085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163469] [ENSMUST00000214372] [ENSMUST00000214756] [ENSMUST00000216195]
Predicted Effect probably benign
Transcript: ENSMUST00000163469
AA Change: L162F

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128332
Gene: ENSMUSG00000090874
AA Change: L162F

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 6.4e-41 PFAM
Pfam:7tm_1 41 288 1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214372
AA Change: L162F

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000214756
AA Change: L162F

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216195
AA Change: L162F

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,531 D122G probably benign Het
3110062M04Rik A T 6: 34,874,658 L114Q probably damaging Het
3425401B19Rik A G 14: 32,663,300 L236P possibly damaging Het
4932415D10Rik T C 10: 82,316,430 Y34C unknown Het
4932415D10Rik A T 10: 82,288,964 Y2737* probably null Het
9030624J02Rik C T 7: 118,794,577 probably null Het
Abca7 T A 10: 80,002,062 D488E probably damaging Het
Adora2a A G 10: 75,333,589 K296E possibly damaging Het
Atp13a4 T A 16: 29,471,956 E225V Het
Bpifb2 A G 2: 153,889,477 M258V possibly damaging Het
Brd2 G A 17: 34,122,257 probably benign Het
Btaf1 G T 19: 37,009,605 V1700F probably damaging Het
C2cd3 A G 7: 100,427,226 I797V Het
Ccdc148 T G 2: 59,009,148 E71A probably damaging Het
Ccdc18 T A 5: 108,206,617 L1074* probably null Het
Ccne2 A G 4: 11,198,772 D215G probably damaging Het
Cers6 T A 2: 68,861,807 probably null Het
Copz1 A G 15: 103,296,544 E110G probably damaging Het
Cped1 A T 6: 22,215,513 D682V probably damaging Het
Crb1 A T 1: 139,237,030 C1180S probably damaging Het
Echdc3 A T 2: 6,189,557 L229Q probably damaging Het
Etfb C T 7: 43,454,576 P145L probably damaging Het
Exoc3l2 G T 7: 19,469,888 R135L Het
Fam83a G A 15: 57,986,173 A38T probably damaging Het
G6pc2 T C 2: 69,223,000 Y133H probably benign Het
Gfy T C 7: 45,178,094 I193V probably benign Het
Ggnbp2 T C 11: 84,854,073 T208A probably benign Het
Gigyf1 T A 5: 137,525,533 M1019K probably damaging Het
Gm15922 T C 7: 3,739,024 E119G not run Het
Gm45783 T C 7: 7,370,600 D61G probably damaging Het
Golga5 T C 12: 102,484,576 probably null Het
Ighe A G 12: 113,271,403 V379A Het
Itpr3 C A 17: 27,094,800 H573Q probably benign Het
Klhl2 A G 8: 64,749,775 L463P probably damaging Het
Large1 T G 8: 72,823,715 M619L probably benign Het
Limd1 T A 9: 123,479,683 V149E probably benign Het
Lyz2 T C 10: 117,282,239 K2E probably damaging Het
Man2c1 T A 9: 57,141,128 S858T probably damaging Het
Nt5dc1 A T 10: 34,304,936 N439K probably benign Het
Olfr1173 T C 2: 88,275,101 probably benign Het
Olfr1178 T C 2: 88,391,880 V211A possibly damaging Het
Olfr1239 A G 2: 89,417,801 I204T probably benign Het
Olfr566 A T 7: 102,857,071 Y70* probably null Het
Olfr845 A C 9: 19,338,813 M118L probably damaging Het
Otogl T C 10: 107,886,982 N296S probably benign Het
Patj A G 4: 98,495,061 N789D probably benign Het
Pcsk6 A G 7: 66,043,566 D851G possibly damaging Het
Peg3 T C 7: 6,709,724 H833R probably damaging Het
Plekha5 A G 6: 140,580,435 D933G probably benign Het
Pnma1 G A 12: 84,147,129 R267C probably damaging Het
Ppp3cb T A 14: 20,508,551 H481L probably benign Het
Prl8a8 T C 13: 27,511,435 probably null Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptpro C A 6: 137,382,649 L406I probably benign Het
Rbpj T C 5: 53,600,934 S18P probably benign Het
Rhbg C T 3: 88,247,579 V173M probably damaging Het
Rps6kc1 A G 1: 190,800,057 S583P probably benign Het
Ryr1 T C 7: 29,095,205 S1217G probably benign Het
S1pr1 A T 3: 115,712,273 I224N probably damaging Het
Sall1 C T 8: 89,031,053 D808N probably benign Het
Shoc2 T C 19: 53,988,036 V119A probably benign Het
Ssh2 A T 11: 77,437,716 E369D probably benign Het
Stx1b C T 7: 127,807,359 V273M possibly damaging Het
Syne2 A G 12: 75,965,880 H2615R probably benign Het
Tmc8 T C 11: 117,784,932 I225T probably benign Het
Tmem126b A G 7: 90,472,646 I52T probably benign Het
Top2b G A 14: 16,416,605 D1122N probably benign Het
Trav13-2 T A 14: 53,634,906 S7T possibly damaging Het
Ttc1 A T 11: 43,745,362 L18Q probably damaging Het
Ttn A T 2: 76,737,209 I27780N probably damaging Het
Ubfd1 T C 7: 122,067,412 S44P probably benign Het
Vmn1r89 A G 7: 13,219,705 K123E probably damaging Het
Vmn2r62 A C 7: 42,787,892 F389L possibly damaging Het
Zdhhc11 T A 13: 73,973,607 M79K possibly damaging Het
Zfp202 G T 9: 40,207,344 V18F possibly damaging Het
Zfp39 A G 11: 58,891,043 F298L possibly damaging Het
Znrf1 G A 8: 111,537,439 G100D probably damaging Het
Other mutations in Olfr733
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Olfr733 APN 14 50298512 missense probably benign 0.00
IGL02247:Olfr733 APN 14 50299114 missense probably damaging 1.00
IGL02307:Olfr733 APN 14 50298838 missense probably damaging 1.00
IGL02492:Olfr733 APN 14 50298603 missense probably damaging 1.00
PIT4378001:Olfr733 UTSW 14 50298898 missense probably benign
R0544:Olfr733 UTSW 14 50298682 missense probably benign 0.20
R1603:Olfr733 UTSW 14 50299034 missense possibly damaging 0.95
R1881:Olfr733 UTSW 14 50299015 missense probably damaging 1.00
R3731:Olfr733 UTSW 14 50298505 missense probably damaging 1.00
R4271:Olfr733 UTSW 14 50298451 missense probably damaging 1.00
R4512:Olfr733 UTSW 14 50298996 missense probably damaging 1.00
R5601:Olfr733 UTSW 14 50298861 missense probably damaging 1.00
R6468:Olfr733 UTSW 14 50298467 missense probably benign 0.02
R6614:Olfr733 UTSW 14 50299037 missense probably benign 0.00
R7013:Olfr733 UTSW 14 50299199 missense probably damaging 0.99
R7083:Olfr733 UTSW 14 50299279 missense possibly damaging 0.81
R7274:Olfr733 UTSW 14 50298422 missense probably benign 0.01
R7653:Olfr733 UTSW 14 50299147 missense possibly damaging 0.82
R7659:Olfr733 UTSW 14 50299241 missense probably benign 0.00
R7885:Olfr733 UTSW 14 50298584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAAGCTGACCTGTGAAC -3'
(R):5'- TCTCCTACAAAGCCTGCATC -3'

Sequencing Primer
(F):5'- AGCTGACCTGTGAACATGGC -3'
(R):5'- TACAAAGCCTGCATCACTCAG -3'
Posted On2019-10-17