Incidental Mutation 'R7591:Ppcdc'
ID587404
Institutional Source Beutler Lab
Gene Symbol Ppcdc
Ensembl Gene ENSMUSG00000063849
Gene Namephosphopantothenoylcysteine decarboxylase
Synonyms1810057I13Rik, 8430432M10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R7591 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location57385095-57440124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57434979 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 20 (V20D)
Ref Sequence ENSEMBL: ENSMUSP00000082856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085709] [ENSMUST00000213194] [ENSMUST00000214065] [ENSMUST00000214144] [ENSMUST00000214166] [ENSMUST00000214339] [ENSMUST00000214624] [ENSMUST00000215299] [ENSMUST00000215883] [ENSMUST00000216365]
Predicted Effect probably damaging
Transcript: ENSMUST00000085709
AA Change: V20D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082856
Gene: ENSMUSG00000063849
AA Change: V20D

DomainStartEndE-ValueType
Pfam:Flavoprotein 18 149 7.9e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213194
AA Change: V20D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214065
AA Change: V20D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214144
AA Change: V20D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214166
AA Change: V20D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000214339
AA Change: V20D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000214624
AA Change: V20D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215299
AA Change: V20D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215883
AA Change: V20D

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000216365
AA Change: V20D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCDC (EC 4.1.1.36), one of the last enzymes in this pathway, converts phosphopantothenoylcysteine to 4-prime-phosphopantetheine (Daugherty et al., 2002 [PubMed 11923312]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C A 10: 82,292,212 V1655F probably benign Het
Ccne2 T C 4: 11,201,393 I307T probably benign Het
Chrm3 A T 13: 9,877,313 C562* probably null Het
Cldn11 A T 3: 31,150,287 E46D probably benign Het
Cyp4a14 A G 4: 115,489,960 probably null Het
Dbh A G 2: 27,170,510 T233A probably damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnttip2 T A 3: 122,276,468 L444* probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epop A T 11: 97,628,332 V317E probably damaging Het
Eppk1 T C 15: 76,107,597 T1695A possibly damaging Het
Fam149a T A 8: 45,350,435 I421F possibly damaging Het
Gm13103 A T 4: 143,850,911 I88L probably benign Het
Impa2 T C 18: 67,318,410 L258P probably damaging Het
Itga1 G A 13: 114,982,779 R855W probably damaging Het
Kcnh5 T C 12: 75,007,767 T468A probably benign Het
Kif11 A G 19: 37,384,263 K33R probably damaging Het
Lamb1 C A 12: 31,326,648 A1657E probably damaging Het
Macc1 T C 12: 119,446,658 V387A probably damaging Het
Nalcn T C 14: 123,323,885 T734A probably benign Het
Nphp3 T C 9: 104,018,278 probably null Het
Nutm2 A G 13: 50,473,867 I461M probably damaging Het
Olfr1178 G A 2: 88,391,876 V210M probably benign Het
Olfr1191-ps1 A C 2: 88,643,467 K233N probably damaging Het
Olfr1466 A G 19: 13,342,255 S166G probably benign Het
Olfr465-ps1 T C 13: 65,144,648 F130L probably benign Het
Pigo T C 4: 43,025,093 N2S probably benign Het
Plcl1 A T 1: 55,697,449 I650L probably benign Het
Rhobtb2 A G 14: 69,799,741 V78A possibly damaging Het
Rp1l1 T C 14: 64,026,109 V226A probably damaging Het
Scrt1 C A 15: 76,519,494 G99C probably damaging Het
Skint9 A T 4: 112,390,950 I199N probably damaging Het
Slc5a4a T C 10: 76,147,667 probably benign Het
Smad3 C T 9: 63,654,717 W326* probably null Het
Spata18 A T 5: 73,672,416 I305F Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syne3 A G 12: 104,940,604 probably null Het
Trim69 G A 2: 122,167,973 R142Q probably benign Het
Vmn1r40 A T 6: 89,714,773 I191F probably benign Het
Vmn2r16 T A 5: 109,362,357 D535E probably damaging Het
Vwa5b2 A G 16: 20,601,567 E742G probably damaging Het
Zfp442 A T 2: 150,408,172 Y603* probably null Het
Zp1 T C 19: 10,919,471 N68S probably damaging Het
Other mutations in Ppcdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Ppcdc APN 9 57415140 missense probably benign 0.00
R0945:Ppcdc UTSW 9 57420158 splice site probably null
R1666:Ppcdc UTSW 9 57414715 missense possibly damaging 0.91
R3684:Ppcdc UTSW 9 57421125 critical splice donor site probably null
R4223:Ppcdc UTSW 9 57414715 missense possibly damaging 0.91
R4821:Ppcdc UTSW 9 57434911 missense probably benign 0.00
R5121:Ppcdc UTSW 9 57421163 missense possibly damaging 0.56
R5236:Ppcdc UTSW 9 57414654 missense probably benign 0.00
R7034:Ppcdc UTSW 9 57415170 missense probably damaging 1.00
R7303:Ppcdc UTSW 9 57414675 missense probably benign
R7835:Ppcdc UTSW 9 57420276 missense probably benign 0.02
R7918:Ppcdc UTSW 9 57420276 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGATCTCCTTCTATACAGACCAGG -3'
(R):5'- AGCTGGGACTTTTAAAGCCC -3'

Sequencing Primer
(F):5'- CCTTCTATACAGACCAGGATTAAGGG -3'
(R):5'- GCAACTCCGGCATTTAGATG -3'
Posted On2019-10-24