Incidental Mutation 'R7591:Zfp442'
ID 587391
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Name zinc finger protein 442
Synonyms OTTMUSG00000015730
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R7591 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 150407141-150451486 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 150408172 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 603 (Y603*)
Ref Sequence ENSEMBL: ENSMUSP00000105542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
AlphaFold A2AQA0
Predicted Effect probably null
Transcript: ENSMUST00000109916
AA Change: Y603*
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: Y603*

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185796
AA Change: Y546*
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130
AA Change: Y546*

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C A 10: 82,292,212 V1655F probably benign Het
Ccne2 T C 4: 11,201,393 I307T probably benign Het
Chrm3 A T 13: 9,877,313 C562* probably null Het
Cldn11 A T 3: 31,150,287 E46D probably benign Het
Cyp4a14 A G 4: 115,489,960 probably null Het
Dbh A G 2: 27,170,510 T233A probably damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnttip2 T A 3: 122,276,468 L444* probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epop A T 11: 97,628,332 V317E probably damaging Het
Eppk1 T C 15: 76,107,597 T1695A possibly damaging Het
Fam149a T A 8: 45,350,435 I421F possibly damaging Het
Gm13103 A T 4: 143,850,911 I88L probably benign Het
Impa2 T C 18: 67,318,410 L258P probably damaging Het
Itga1 G A 13: 114,982,779 R855W probably damaging Het
Kcnh5 T C 12: 75,007,767 T468A probably benign Het
Kif11 A G 19: 37,384,263 K33R probably damaging Het
Lamb1 C A 12: 31,326,648 A1657E probably damaging Het
Macc1 T C 12: 119,446,658 V387A probably damaging Het
Nalcn T C 14: 123,323,885 T734A probably benign Het
Nphp3 T C 9: 104,018,278 probably null Het
Nutm2 A G 13: 50,473,867 I461M probably damaging Het
Olfr1178 G A 2: 88,391,876 V210M probably benign Het
Olfr1191-ps1 A C 2: 88,643,467 K233N probably damaging Het
Olfr1466 A G 19: 13,342,255 S166G probably benign Het
Olfr465-ps1 T C 13: 65,144,648 F130L probably benign Het
Pigo T C 4: 43,025,093 N2S probably benign Het
Plcl1 A T 1: 55,697,449 I650L probably benign Het
Ppcdc A T 9: 57,434,979 V20D probably damaging Het
Rhobtb2 A G 14: 69,799,741 V78A possibly damaging Het
Rp1l1 T C 14: 64,026,109 V226A probably damaging Het
Scrt1 C A 15: 76,519,494 G99C probably damaging Het
Skint9 A T 4: 112,390,950 I199N probably damaging Het
Slc5a4a T C 10: 76,147,667 probably benign Het
Smad3 C T 9: 63,654,717 W326* probably null Het
Spata18 A T 5: 73,672,416 I305F Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syne3 A G 12: 104,940,604 probably null Het
Trim69 G A 2: 122,167,973 R142Q probably benign Het
Vmn1r40 A T 6: 89,714,773 I191F probably benign Het
Vmn2r16 T A 5: 109,362,357 D535E probably damaging Het
Vwa5b2 A G 16: 20,601,567 E742G probably damaging Het
Zp1 T C 19: 10,919,471 N68S probably damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150408709 missense unknown
R8528:Zfp442 UTSW 2 150409042 missense probably damaging 1.00
R9110:Zfp442 UTSW 2 150408173 missense probably benign 0.30
R9269:Zfp442 UTSW 2 150409367 missense probably benign 0.19
R9371:Zfp442 UTSW 2 150408756 missense unknown
R9401:Zfp442 UTSW 2 150409695 missense possibly damaging 0.53
R9459:Zfp442 UTSW 2 150408748 missense unknown
R9711:Zfp442 UTSW 2 150408287 missense possibly damaging 0.93
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAAATGTACAAAGGCTTCACCATATT -3'
(R):5'- GGGTTTCAAAGTGGTCTGCAAA -3'

Sequencing Primer
(F):5'- CTCTGAAGATGTCTGACATGCCAAG -3'
(R):5'- AGGCATTTGCATGTCAAGC -3'
Posted On 2019-10-24