Incidental Mutation 'R7600:Dnajc9'
ID587981
Institutional Source Beutler Lab
Gene Symbol Dnajc9
Ensembl Gene ENSMUSG00000021811
Gene NameDnaJ heat shock protein family (Hsp40) member C9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7600 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location20384638-20388910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20388725 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 20 (L20P)
Ref Sequence ENSEMBL: ENSMUSP00000022345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022345] [ENSMUST00000061444]
Predicted Effect probably damaging
Transcript: ENSMUST00000022345
AA Change: L20P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022345
Gene: ENSMUSG00000021811
AA Change: L20P

DomainStartEndE-ValueType
DnaJ 14 74 2.76e-16 SMART
coiled coil region 176 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061444
SMART Domains Protein: ENSMUSP00000055619
Gene: ENSMUSG00000049960

DomainStartEndE-ValueType
Pfam:Ribosomal_S16 24 84 9.9e-25 PFAM
low complexity region 107 135 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,817 V707I probably benign Het
AF067063 A T 13: 119,828,696 probably null Het
Ahnak A T 19: 9,004,574 D1074V possibly damaging Het
Aldh4a1 A G 4: 139,645,004 M495V probably benign Het
Atxn1 T G 13: 45,557,060 K799Q possibly damaging Het
Catsperg2 A T 7: 29,704,858 S831T probably benign Het
Cldn1 T C 16: 26,360,919 T133A probably benign Het
Clec12b A G 6: 129,376,263 C254R probably damaging Het
Cnnm2 A T 19: 46,762,067 T99S probably benign Het
Col6a4 T G 9: 106,066,999 D1092A possibly damaging Het
Dsp C A 13: 38,191,715 Q1159K probably damaging Het
Dst C T 1: 34,266,930 T4110I probably damaging Het
Epb42 A G 2: 121,021,826 L562P probably damaging Het
Fras1 T C 5: 96,684,436 Y1543H probably damaging Het
Igkv1-117 T A 6: 68,121,116 V9E possibly damaging Het
Kbtbd8 T A 6: 95,122,592 Y361N probably damaging Het
Lrp1 C T 10: 127,555,706 R2948H probably benign Het
Lrp10 G T 14: 54,469,395 R563L possibly damaging Het
Mllt3 G T 4: 87,841,219 H197Q probably benign Het
Myo18b G A 5: 112,878,103 P27L unknown Het
Nlrp1a C A 11: 71,098,914 R1110L probably damaging Het
Nol10 T G 12: 17,369,480 D257E probably damaging Het
Olfm3 T C 3: 115,096,940 V114A possibly damaging Het
Olfr224 T C 11: 58,567,336 N3S probably benign Het
Olfr47 C A 6: 43,235,836 T76K probably damaging Het
Pdzd2 G T 15: 12,372,734 D2438E probably damaging Het
Prl7a2 T G 13: 27,659,281 I180L possibly damaging Het
Ptch2 A T 4: 117,096,225 probably benign Het
Snrpn A G 7: 59,988,603 M1T probably null Het
Sntb1 A T 15: 55,792,188 W211R possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Sytl2 T C 7: 90,376,144 S447P probably benign Het
Tas2r129 G T 6: 132,951,174 G25* probably null Het
Tle2 T G 10: 81,586,313 Y396* probably null Het
Trpm2 T C 10: 77,938,051 K510R probably benign Het
Trpm3 A G 19: 22,926,094 T1073A possibly damaging Het
Ttc24 A T 3: 88,072,013 M1K probably null Het
Tubgcp5 A G 7: 55,808,513 T391A probably benign Het
Vmn1r17 T C 6: 57,360,921 E153G probably benign Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Zcwpw1 A T 5: 137,800,134 K198* probably null Het
Zfp142 A G 1: 74,573,668 V641A probably damaging Het
Zfp318 C T 17: 46,384,284 A149V possibly damaging Het
Zfp608 T C 18: 54,988,020 N165S probably damaging Het
Other mutations in Dnajc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Dnajc9 APN 14 20385447 missense probably benign 0.01
IGL01631:Dnajc9 APN 14 20388108 missense probably benign 0.02
R1257:Dnajc9 UTSW 14 20388697 splice site probably null
R1258:Dnajc9 UTSW 14 20388697 splice site probably null
R1261:Dnajc9 UTSW 14 20388697 splice site probably null
R1765:Dnajc9 UTSW 14 20388090 missense possibly damaging 0.73
R1835:Dnajc9 UTSW 14 20388334 missense possibly damaging 0.89
R7218:Dnajc9 UTSW 14 20388439 missense probably benign 0.02
R7570:Dnajc9 UTSW 14 20388644 missense probably benign 0.01
R7960:Dnajc9 UTSW 14 20388696 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCTTCCCAAGATCTGTAAGCAG -3'
(R):5'- CAGGCGCCCAGAGTTATTTG -3'

Sequencing Primer
(F):5'- GCAGAGTATCCAAAAGTCATCCTG -3'
(R):5'- CCCAGAGTTATTTGGGCGG -3'
Posted On2019-10-24