Incidental Mutation 'R7600:Sntb1'
ID587984
Institutional Source Beutler Lab
Gene Symbol Sntb1
Ensembl Gene ENSMUSG00000060429
Gene Namesyntrophin, basic 1
Synonyms59-1 DAP, beta1-Syntrophin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7600 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location55636388-55906949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55792188 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 211 (W211R)
Ref Sequence ENSEMBL: ENSMUSP00000041294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039769] [ENSMUST00000110200]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039769
AA Change: W211R

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: W211R

DomainStartEndE-ValueType
PH 19 299 5.14e0 SMART
PDZ 120 194 4.5e-17 SMART
PH 322 434 2.81e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110200
AA Change: W211R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105829
Gene: ENSMUSG00000060429
AA Change: W211R

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
PDZ 120 194 4.5e-17 SMART
Meta Mutation Damage Score 0.2302 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,817 V707I probably benign Het
AF067063 A T 13: 119,828,696 probably null Het
Ahnak A T 19: 9,004,574 D1074V possibly damaging Het
Aldh4a1 A G 4: 139,645,004 M495V probably benign Het
Atxn1 T G 13: 45,557,060 K799Q possibly damaging Het
Catsperg2 A T 7: 29,704,858 S831T probably benign Het
Cldn1 T C 16: 26,360,919 T133A probably benign Het
Clec12b A G 6: 129,376,263 C254R probably damaging Het
Cnnm2 A T 19: 46,762,067 T99S probably benign Het
Col6a4 T G 9: 106,066,999 D1092A possibly damaging Het
Dnajc9 A G 14: 20,388,725 L20P probably damaging Het
Dsp C A 13: 38,191,715 Q1159K probably damaging Het
Dst C T 1: 34,266,930 T4110I probably damaging Het
Epb42 A G 2: 121,021,826 L562P probably damaging Het
Fras1 T C 5: 96,684,436 Y1543H probably damaging Het
Igkv1-117 T A 6: 68,121,116 V9E possibly damaging Het
Kbtbd8 T A 6: 95,122,592 Y361N probably damaging Het
Lrp1 C T 10: 127,555,706 R2948H probably benign Het
Lrp10 G T 14: 54,469,395 R563L possibly damaging Het
Mllt3 G T 4: 87,841,219 H197Q probably benign Het
Myo18b G A 5: 112,878,103 P27L unknown Het
Nlrp1a C A 11: 71,098,914 R1110L probably damaging Het
Nol10 T G 12: 17,369,480 D257E probably damaging Het
Olfm3 T C 3: 115,096,940 V114A possibly damaging Het
Olfr224 T C 11: 58,567,336 N3S probably benign Het
Olfr47 C A 6: 43,235,836 T76K probably damaging Het
Pdzd2 G T 15: 12,372,734 D2438E probably damaging Het
Prl7a2 T G 13: 27,659,281 I180L possibly damaging Het
Ptch2 A T 4: 117,096,225 probably benign Het
Snrpn A G 7: 59,988,603 M1T probably null Het
Sp110 G A 1: 85,579,092 R417C Het
Sytl2 T C 7: 90,376,144 S447P probably benign Het
Tas2r129 G T 6: 132,951,174 G25* probably null Het
Tle2 T G 10: 81,586,313 Y396* probably null Het
Trpm2 T C 10: 77,938,051 K510R probably benign Het
Trpm3 A G 19: 22,926,094 T1073A possibly damaging Het
Ttc24 A T 3: 88,072,013 M1K probably null Het
Tubgcp5 A G 7: 55,808,513 T391A probably benign Het
Vmn1r17 T C 6: 57,360,921 E153G probably benign Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Zcwpw1 A T 5: 137,800,134 K198* probably null Het
Zfp142 A G 1: 74,573,668 V641A probably damaging Het
Zfp318 C T 17: 46,384,284 A149V possibly damaging Het
Zfp608 T C 18: 54,988,020 N165S probably damaging Het
Other mutations in Sntb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Sntb1 APN 15 55648039 missense possibly damaging 0.93
IGL02732:Sntb1 APN 15 55792200 missense possibly damaging 0.62
IGL02965:Sntb1 APN 15 55642685 nonsense probably null
IGL03084:Sntb1 APN 15 55792091 missense probably damaging 0.99
IGL03286:Sntb1 APN 15 55792046 missense possibly damaging 0.59
R0117:Sntb1 UTSW 15 55906353 missense probably benign
R0178:Sntb1 UTSW 15 55906144 missense probably damaging 0.98
R0465:Sntb1 UTSW 15 55749276 missense probably benign 0.02
R0626:Sntb1 UTSW 15 55642783 missense probably benign 0.20
R0726:Sntb1 UTSW 15 55676356 missense probably benign
R1125:Sntb1 UTSW 15 55749280 missense probably benign
R1443:Sntb1 UTSW 15 55647955 missense probably damaging 1.00
R1888:Sntb1 UTSW 15 55749349 nonsense probably null
R1888:Sntb1 UTSW 15 55749349 nonsense probably null
R2208:Sntb1 UTSW 15 55906318 missense possibly damaging 0.79
R2426:Sntb1 UTSW 15 55906179 missense probably damaging 1.00
R3721:Sntb1 UTSW 15 55642818 missense probably benign 0.10
R4370:Sntb1 UTSW 15 55792091 missense probably damaging 0.99
R4706:Sntb1 UTSW 15 55749274 missense probably benign 0.09
R4883:Sntb1 UTSW 15 55642802 nonsense probably null
R5223:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5242:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5270:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5313:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5314:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5316:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5336:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5337:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5396:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5398:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5427:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5428:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5429:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5431:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5594:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5658:Sntb1 UTSW 15 55792076 missense probably damaging 1.00
R5665:Sntb1 UTSW 15 55792139 missense probably benign 0.00
R6147:Sntb1 UTSW 15 55648010 missense probably benign
R6159:Sntb1 UTSW 15 55676302 critical splice donor site probably null
R6883:Sntb1 UTSW 15 55906323 missense probably benign 0.38
R7008:Sntb1 UTSW 15 55792072 nonsense probably null
R7168:Sntb1 UTSW 15 55791265 missense probably benign 0.00
R7511:Sntb1 UTSW 15 55647951 missense possibly damaging 0.71
R8242:Sntb1 UTSW 15 55792233 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCAAATTCTGTCATAACCTCAGAGG -3'
(R):5'- GAGCCTTGAGTCCAATTAGACAG -3'

Sequencing Primer
(F):5'- TCTGTCATAACCTCAGAGGCTAGG -3'
(R):5'- GAGTCCAATTAGACAGCTGTTGACC -3'
Posted On2019-10-24