Incidental Mutation 'R7627:Hist1h2ak'
ID589512
Institutional Source Beutler Lab
Gene Symbol Hist1h2ak
Ensembl Gene ENSMUSG00000063021
Gene Namehistone cluster 1, H2ak
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R7627 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location21753435-21753827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21753746 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 28 (V28L)
Ref Sequence ENSEMBL: ENSMUSP00000074310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074752] [ENSMUST00000091709] [ENSMUST00000102983]
Predicted Effect probably benign
Transcript: ENSMUST00000074752
AA Change: V28L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074310
Gene: ENSMUSG00000063021
AA Change: V28L

DomainStartEndE-ValueType
H2A 3 123 1.22e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091709
SMART Domains Protein: ENSMUSP00000089301
Gene: ENSMUSG00000095217

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102983
SMART Domains Protein: ENSMUSP00000100048
Gene: ENSMUSG00000064288

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Hist1h2ak
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4576001:Hist1h2ak UTSW 13 21753611 missense probably damaging 1.00
R4585:Hist1h2ak UTSW 13 21753712 missense possibly damaging 0.92
R4586:Hist1h2ak UTSW 13 21753712 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TATCAAGGGCCTCACTTCCC -3'
(R):5'- ATTGGTCTAGGTGCAATGCTTC -3'

Sequencing Primer
(F):5'- TCTTCTTGGGCAGCAGC -3'
(R):5'- GGTGCAATGCTTCTATGTAACC -3'
Posted On2019-10-24