Incidental Mutation 'R7627:Gnat3'
ID589488
Institutional Source Beutler Lab
Gene Symbol Gnat3
Ensembl Gene ENSMUSG00000028777
Gene Nameguanine nucleotide binding protein, alpha transducing 3
SynonymsGtn, Ggust, alpha-gustducin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7627 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location17962549-18019834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17999748 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 133 (D133V)
Ref Sequence ENSEMBL: ENSMUSP00000030561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030561]
Predicted Effect
SMART Domains Protein: ENSMUSP00000030561
Gene: ENSMUSG00000028777
AA Change: D133V

DomainStartEndE-ValueType
G_alpha 13 353 3.06e-221 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sweet, bitter, and umami tastes are transmitted from taste receptors by a specific guanine nucleotide binding protein. The protein encoded by this gene is the alpha subunit of this heterotrimeric G protein, which is found not only in the oral epithelium but also in gut tissues. Variations in this gene have been linked to metabolic syndrome. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal taste sensitivity. Mice show reduced behavioral and electrophysiological responses to bitter, sweet, and unami compounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Gnat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Gnat3 APN 5 18003751 splice site probably benign
IGL01023:Gnat3 APN 5 18003828 missense probably damaging 1.00
IGL01997:Gnat3 APN 5 17999723 nonsense probably null
PIT4377001:Gnat3 UTSW 5 18015559 missense
R0556:Gnat3 UTSW 5 18019598 missense probably damaging 1.00
R1624:Gnat3 UTSW 5 18003843 missense possibly damaging 0.66
R1934:Gnat3 UTSW 5 18019510 missense possibly damaging 0.74
R2319:Gnat3 UTSW 5 18019626 missense probably benign 0.17
R3928:Gnat3 UTSW 5 18003894 splice site probably benign
R4169:Gnat3 UTSW 5 18003864 missense probably damaging 1.00
R4420:Gnat3 UTSW 5 17999801 missense probably damaging 1.00
R4632:Gnat3 UTSW 5 18015366 splice site probably null
R4651:Gnat3 UTSW 5 18015570 missense probably damaging 1.00
R4652:Gnat3 UTSW 5 18015570 missense probably damaging 1.00
R5471:Gnat3 UTSW 5 17991324 missense probably damaging 1.00
R7460:Gnat3 UTSW 5 17999658 missense
R7637:Gnat3 UTSW 5 18003772 missense
R8342:Gnat3 UTSW 5 18003840 missense
R8428:Gnat3 UTSW 5 18015314 missense possibly damaging 0.89
X0064:Gnat3 UTSW 5 18003840 missense possibly damaging 0.74
Z1088:Gnat3 UTSW 5 18015323 missense probably damaging 1.00
Z1177:Gnat3 UTSW 5 18015313 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAATTTTCCAAAGGTCAGC -3'
(R):5'- ACGCATGCCATCTGTCTGTG -3'

Sequencing Primer
(F):5'- GGAACAAAAACCTTTTAGCGTGCTC -3'
(R):5'- CTGCAGAGTCATTGAGCT -3'
Posted On2019-10-24