Mutagenetix > Incidental Mutations

Incidental Mutation 'R0055:Rps6ka5'

58980

Institutional Source

Beutler Lab

Gene Symbol

Rps6ka5

Ensembl Gene

ENSMUSG00000021180

Gene Name

ribosomal protein S6 kinase, polypeptide 5

Synonyms

6330404E13Rik, MSK1, 3110005L17Rik

MMRRC Submission

038349-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0055 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100548439-100726983 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 100678580 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 37 (T37I)

Ref Sequence

ENSEMBL: ENSMUSP00000152481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043599] [ENSMUST00000222731]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043599
AA Change: T37I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000042987
Gene: ENSMUSG00000021180
AA Change: T37I

Domain	Start	End	E-Value	Type
low complexity region	2	22	N/A	INTRINSIC
S_TKc	48	317	1.08e-101	SMART
S_TK_X	318	378	2.45e-13	SMART
S_TKc	425	751	1.1e-75	SMART
low complexity region	812	832	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222347

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222403

Predicted Effect

probably damaging
Transcript: ENSMUST00000222731
AA Change: T37I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

Meta Mutation Damage Score

0.1270

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

98% (59/60)

MGI Phenotype

PHENOTYPE: Mice homozygous for a mutant allele exhibit altered response to cocaine including decreased hyperlocomotor activity and sensitization at a lower dose. Mice homozygous for a kinase dead allele exhibit altered experience-dependent synaptic plasticity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	A	T	8: 45,968,161	S108R	probably damaging	Het
2010300C02Rik	A	C	1: 37,624,256	S854A	probably benign	Het
2210016F16Rik	T	C	13: 58,384,166	D192G	probably damaging	Het
4921501E09Rik	A	T	17: 33,066,722	W369R	probably damaging	Het
A2ml1	T	C	6: 128,570,094		probably benign	Het
Atp6v1h	A	T	1: 5,084,454	T2S	probably benign	Het
Bcl11b	G	A	12: 107,965,777	P179S	probably benign	Het
Cacna1a	C	T	8: 84,580,058		probably benign	Het
Ccdc146	C	T	5: 21,297,006		probably null	Het
Ccdc61	T	C	7: 18,892,536	D128G	probably damaging	Het
Cd55	A	G	1: 130,459,576		probably benign	Het
Cdk7	C	A	13: 100,719,304	E99*	probably null	Het
Cox8a	A	T	19: 7,217,509	S2T	probably damaging	Het
Dennd5a	A	G	7: 109,899,791	I955T	possibly damaging	Het
Dopey1	A	C	9: 86,512,652	E602A	probably benign	Het
Ephx4	T	C	5: 107,413,078	L32S	probably damaging	Het
Fbxo21	T	A	5: 118,000,490	D493E	probably benign	Het
Frmd4b	A	T	6: 97,323,649		probably benign	Het
Fzd1	A	T	5: 4,756,037	M515K	possibly damaging	Het
Gli2	A	G	1: 118,890,408		probably benign	Het
Gm12887	T	A	4: 121,616,469	K61N	probably damaging	Het
Grin2a	A	T	16: 9,669,807	V409D	probably damaging	Het
Grin2b	T	C	6: 135,923,203	I227V	probably benign	Het
Helz2	T	G	2: 181,228,821	D2879A	possibly damaging	Het
Itpr2	T	C	6: 146,323,133	N1453S	probably benign	Het
Itpr3	C	A	17: 27,098,322	S817Y	probably damaging	Het
Lin7c	T	A	2: 109,896,453		probably benign	Het
Ly75	T	C	2: 60,321,918	E1097G	probably benign	Het
Mcm10	T	C	2: 4,991,407	N882D	probably damaging	Het
Mettl13	A	T	1: 162,546,181	L167Q	probably damaging	Het
Morn2	A	T	17: 80,295,513	M1L	probably benign	Het
Mybph	G	T	1: 134,193,852	V88L	probably damaging	Het
Nefm	T	A	14: 68,121,199		probably benign	Het
Nf1	A	G	11: 79,471,551	E1497G	probably damaging	Het
Olfr1281	T	A	2: 111,328,525	Y35*	probably null	Het
Olfr137	T	C	17: 38,304,811	S217G	possibly damaging	Het
Olfr615	A	G	7: 103,561,037	K187E	probably damaging	Het
Olfr670	T	A	7: 104,960,496	T79S	possibly damaging	Het
Plcd3	C	G	11: 103,077,585	W382S	probably damaging	Het
Plxna1	T	A	6: 89,329,739	I1370F	possibly damaging	Het
Rarb	G	A	14: 16,509,066	R106C	probably damaging	Het
Runx1	G	T	16: 92,644,141		probably benign	Het
Scube1	A	G	15: 83,634,736	V301A	probably damaging	Het
Sema3a	A	T	5: 13,400,037	N27I	possibly damaging	Het
Slc15a3	G	T	19: 10,843,042	E8*	probably null	Het
Slc22a5	T	C	11: 53,891,206	S112G	probably benign	Het
Slc25a45	T	C	19: 5,880,467	F3L	probably damaging	Het
Slc4a4	A	C	5: 89,156,336	H502P	possibly damaging	Het
Slfn10-ps	A	G	11: 83,030,300		noncoding transcript	Het
Slit2	C	A	5: 48,281,726	C1077*	probably null	Het
Spn	A	G	7: 127,136,322	F82L	possibly damaging	Het
Tbccd1	A	G	16: 22,841,905	W54R	probably damaging	Het
Ucp1	G	T	8: 83,290,604	E8*	probably null	Het
Unc80	A	T	1: 66,506,623		probably benign	Het
Vsnl1	A	T	12: 11,386,986		probably null	Het
Zdhhc11	C	T	13: 73,982,686	Q295*	probably null	Het
Zfp457	T	A	13: 67,294,034	H63L	probably damaging	Het

Other mutations in Rps6ka5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01072:Rps6ka5	APN	12	100573898	missense	probably benign
IGL01450:Rps6ka5	APN	12	100552991	splice site	probably benign
IGL01586:Rps6ka5	APN	12	100570914	missense	probably damaging	0.99
IGL01743:Rps6ka5	APN	12	100575633	critical splice donor site	probably null
IGL02995:Rps6ka5	APN	12	100573999	intron	probably benign
IGL03051:Rps6ka5	APN	12	100615991	splice site	probably null
IGL03190:Rps6ka5	APN	12	100558648	splice site	probably benign
chard	UTSW	12	100616083	missense	probably damaging	1.00
Ramp	UTSW	12	100575705	missense	possibly damaging	0.85
zwiebel	UTSW	12	100678538	missense	probably damaging	0.99
R0055:Rps6ka5	UTSW	12	100678580	missense	probably damaging	0.97
R0067:Rps6ka5	UTSW	12	100616083	missense	probably damaging	1.00
R0212:Rps6ka5	UTSW	12	100553169	splice site	probably null
R0761:Rps6ka5	UTSW	12	100570882	missense	probably damaging	1.00
R0893:Rps6ka5	UTSW	12	100574438	missense	possibly damaging	0.71
R1237:Rps6ka5	UTSW	12	100575705	missense	possibly damaging	0.85
R1254:Rps6ka5	UTSW	12	100619529	missense	probably damaging	1.00
R1447:Rps6ka5	UTSW	12	100577825	missense	probably benign	0.02
R1611:Rps6ka5	UTSW	12	100570852	missense	possibly damaging	0.77
R2086:Rps6ka5	UTSW	12	100619615	missense	possibly damaging	0.67
R2129:Rps6ka5	UTSW	12	100678538	missense	probably damaging	0.99
R2298:Rps6ka5	UTSW	12	100551454	missense	probably damaging	0.99
R2432:Rps6ka5	UTSW	12	100554405	missense	probably damaging	0.98
R4378:Rps6ka5	UTSW	12	100597937	missense	probably damaging	1.00
R4394:Rps6ka5	UTSW	12	100581319	missense	probably damaging	0.97
R4461:Rps6ka5	UTSW	12	100570864	missense	probably damaging	0.99
R4584:Rps6ka5	UTSW	12	100581318	missense	probably damaging	1.00
R4672:Rps6ka5	UTSW	12	100654287	missense	possibly damaging	0.93
R4706:Rps6ka5	UTSW	12	100581319	missense	probably damaging	0.97
R4706:Rps6ka5	UTSW	12	100597885	splice site	probably null
R4707:Rps6ka5	UTSW	12	100597885	splice site	probably null
R4966:Rps6ka5	UTSW	12	100553066	missense	probably benign	0.01
R5059:Rps6ka5	UTSW	12	100554375	missense	probably damaging	0.96
R5404:Rps6ka5	UTSW	12	100616093	missense	probably damaging	1.00
R5660:Rps6ka5	UTSW	12	100619580	missense	possibly damaging	0.95
R5678:Rps6ka5	UTSW	12	100724876	missense	unknown
R5992:Rps6ka5	UTSW	12	100575250	missense	possibly damaging	0.68
R6104:Rps6ka5	UTSW	12	100553148	missense	possibly damaging	0.84
R6163:Rps6ka5	UTSW	12	100595920	critical splice acceptor site	probably null
R6390:Rps6ka5	UTSW	12	100570992	missense	probably damaging	0.99
R6599:Rps6ka5	UTSW	12	100597909	missense	probably damaging	1.00
R6653:Rps6ka5	UTSW	12	100551536	missense	probably damaging	1.00
R6693:Rps6ka5	UTSW	12	100573829	missense	probably benign	0.11
R7009:Rps6ka5	UTSW	12	100619537	missense	probably damaging	1.00
R7157:Rps6ka5	UTSW	12	100581420	missense	probably damaging	1.00
R7196:Rps6ka5	UTSW	12	100595864	missense	possibly damaging	0.77
R7510:Rps6ka5	UTSW	12	100616068	missense	possibly damaging	0.56
R7565:Rps6ka5	UTSW	12	100616083	missense	probably damaging	1.00
R7800:Rps6ka5	UTSW	12	100558565	missense	probably damaging	0.97
R7843:Rps6ka5	UTSW	12	100553149	missense	possibly damaging	0.92
R8009:Rps6ka5	UTSW	12	100577789	missense	probably damaging	0.97
R8057:Rps6ka5	UTSW	12	100573796	critical splice donor site	probably null
R8292:Rps6ka5	UTSW	12	100678532	missense	possibly damaging	0.83
R8324:Rps6ka5	UTSW	12	100558487	missense	possibly damaging	0.92
R8428:Rps6ka5	UTSW	12	100575241	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCTTCTAAAACTGCCAATGACTTCCAC -3'
(R):5'- GCTAGTGTAGATTAGCTCATGCCCAC -3'

Sequencing Primer
(F):5'- TGCCAATGACTTCCACATAAAGG -3'
(R):5'- tccttctgtgtccctccc -3'

Posted On

2013-07-11