Incidental Mutation 'R8009:Rps6ka5'
ID616819
Institutional Source Beutler Lab
Gene Symbol Rps6ka5
Ensembl Gene ENSMUSG00000021180
Gene Nameribosomal protein S6 kinase, polypeptide 5
Synonyms6330404E13Rik, MSK1, 3110005L17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8009 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location100548439-100726983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100577789 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 350 (E350G)
Ref Sequence ENSEMBL: ENSMUSP00000042987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043599] [ENSMUST00000222731]
Predicted Effect probably damaging
Transcript: ENSMUST00000043599
AA Change: E350G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042987
Gene: ENSMUSG00000021180
AA Change: E350G

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
S_TKc 48 317 1.08e-101 SMART
S_TK_X 318 378 2.45e-13 SMART
S_TKc 425 751 1.1e-75 SMART
low complexity region 812 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221356
Predicted Effect probably damaging
Transcript: ENSMUST00000222731
AA Change: E350G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a mutant allele exhibit altered response to cocaine including decreased hyperlocomotor activity and sensitization at a lower dose. Mice homozygous for a kinase dead allele exhibit altered experience-dependent synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Baz1a A T 12: 54,895,031 Y1466* probably null Het
Casc4 T C 2: 121,906,761 V261A probably benign Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Esyt1 T C 10: 128,511,485 E1057G probably benign Het
Fsip2 A G 2: 82,988,449 E4842G possibly damaging Het
Gadd45b G A 10: 80,931,150 V90I probably benign Het
Gfi1 T A 5: 107,723,801 H79L probably damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Itsn2 G A 12: 4,664,553 A950T probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Lrch3 A T 16: 33,005,713 D720V possibly damaging Het
Lrrk1 T C 7: 66,265,474 D1622G possibly damaging Het
Meioc G C 11: 102,676,743 A788P probably damaging Het
Mmp1a A T 9: 7,467,235 T271S possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1089 A G 2: 86,733,504 L36P probably damaging Het
Olfr126 A T 17: 37,850,802 D70V probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Phactr3 A C 2: 178,332,944 R523S probably damaging Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Prkcg A G 7: 3,314,192 D294G probably benign Het
Psg28 T A 7: 18,422,997 I438L probably damaging Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Sgce T C 6: 4,691,636 D313G probably damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Stxbp5 A G 10: 9,816,302 V366A probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tlr3 G A 8: 45,400,782 T167M not run Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tmprss15 C T 16: 79,090,863 V19M probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Uso1 A T 5: 92,166,580 E115D probably benign Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Other mutations in Rps6ka5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Rps6ka5 APN 12 100573898 missense probably benign
IGL01450:Rps6ka5 APN 12 100552991 splice site probably benign
IGL01586:Rps6ka5 APN 12 100570914 missense probably damaging 0.99
IGL01743:Rps6ka5 APN 12 100575633 critical splice donor site probably null
IGL02995:Rps6ka5 APN 12 100573999 intron probably benign
IGL03051:Rps6ka5 APN 12 100615991 splice site probably null
IGL03190:Rps6ka5 APN 12 100558648 splice site probably benign
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0067:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R0212:Rps6ka5 UTSW 12 100553169 splice site probably null
R0761:Rps6ka5 UTSW 12 100570882 missense probably damaging 1.00
R0893:Rps6ka5 UTSW 12 100574438 missense possibly damaging 0.71
R1237:Rps6ka5 UTSW 12 100575705 missense possibly damaging 0.85
R1254:Rps6ka5 UTSW 12 100619529 missense probably damaging 1.00
R1447:Rps6ka5 UTSW 12 100577825 missense probably benign 0.02
R1611:Rps6ka5 UTSW 12 100570852 missense possibly damaging 0.77
R2086:Rps6ka5 UTSW 12 100619615 missense possibly damaging 0.67
R2129:Rps6ka5 UTSW 12 100678538 missense probably damaging 0.99
R2298:Rps6ka5 UTSW 12 100551454 missense probably damaging 0.99
R2432:Rps6ka5 UTSW 12 100554405 missense probably damaging 0.98
R4378:Rps6ka5 UTSW 12 100597937 missense probably damaging 1.00
R4394:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4461:Rps6ka5 UTSW 12 100570864 missense probably damaging 0.99
R4584:Rps6ka5 UTSW 12 100581318 missense probably damaging 1.00
R4672:Rps6ka5 UTSW 12 100654287 missense possibly damaging 0.93
R4706:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4706:Rps6ka5 UTSW 12 100597885 splice site probably null
R4707:Rps6ka5 UTSW 12 100597885 splice site probably null
R4966:Rps6ka5 UTSW 12 100553066 missense probably benign 0.01
R5059:Rps6ka5 UTSW 12 100554375 missense probably damaging 0.96
R5404:Rps6ka5 UTSW 12 100616093 missense probably damaging 1.00
R5660:Rps6ka5 UTSW 12 100619580 missense possibly damaging 0.95
R5678:Rps6ka5 UTSW 12 100724876 missense unknown
R5992:Rps6ka5 UTSW 12 100575250 missense possibly damaging 0.68
R6104:Rps6ka5 UTSW 12 100553148 missense possibly damaging 0.84
R6163:Rps6ka5 UTSW 12 100595920 critical splice acceptor site probably null
R6390:Rps6ka5 UTSW 12 100570992 missense probably damaging 0.99
R6599:Rps6ka5 UTSW 12 100597909 missense probably damaging 1.00
R6653:Rps6ka5 UTSW 12 100551536 missense probably damaging 1.00
R6693:Rps6ka5 UTSW 12 100573829 missense probably benign 0.11
R7009:Rps6ka5 UTSW 12 100619537 missense probably damaging 1.00
R7157:Rps6ka5 UTSW 12 100581420 missense probably damaging 1.00
R7196:Rps6ka5 UTSW 12 100595864 missense possibly damaging 0.77
R7510:Rps6ka5 UTSW 12 100616068 missense possibly damaging 0.56
R7565:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R7800:Rps6ka5 UTSW 12 100558565 missense probably damaging 0.97
R7843:Rps6ka5 UTSW 12 100553149 missense possibly damaging 0.92
R7926:Rps6ka5 UTSW 12 100553149 missense possibly damaging 0.92
R8057:Rps6ka5 UTSW 12 100573796 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAAACTTCCAGATAGTACCTC -3'
(R):5'- CAGACTTGCTAGTAACTGTGCTC -3'

Sequencing Primer
(F):5'- TTCCAGATAGTACCTCAACATATCTC -3'
(R):5'- CTTGCTGTGCTCTAGAAG -3'
Posted On2020-01-23