Incidental Mutation 'R7661:Ndufa5'
ID591560
Institutional Source Beutler Lab
Gene Symbol Ndufa5
Ensembl Gene ENSMUSG00000023089
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7661 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location24518666-24528013 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 24518725 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 117 (*117R)
Ref Sequence ENSEMBL: ENSMUSP00000023851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023851] [ENSMUST00000052277] [ENSMUST00000118558]
Predicted Effect probably null
Transcript: ENSMUST00000023851
AA Change: *117R
SMART Domains Protein: ENSMUSP00000023851
Gene: ENSMUSG00000023089
AA Change: *117R

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:ETC_C1_NDUFA5 19 73 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052277
SMART Domains Protein: ENSMUSP00000051177
Gene: ENSMUSG00000046192

DomainStartEndE-ValueType
PDB:2DAF|A 119 216 1e-38 PDB
Blast:UBQ 129 199 3e-26 BLAST
low complexity region 218 229 N/A INTRINSIC
low complexity region 289 306 N/A INTRINSIC
IQ 333 355 1.74e-1 SMART
low complexity region 357 383 N/A INTRINSIC
low complexity region 735 742 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118558
AA Change: *78R
SMART Domains Protein: ENSMUSP00000112971
Gene: ENSMUSG00000023089
AA Change: *78R

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a conserved protein that comprises the B13 subunit of complex I of the mitochondrial respiratory chain. The encoded protein localizes to the inner mitochondrial membrane, where it is thought to aid in the transfer of electrons from NADH to ubiquinone. Alternative splicing results in multiple transcript variants. There are numerous pseudogenes of this gene on chromosomes 1, 3, 6, 8, 9, 11, 12, and 16. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality at E9. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Ndufa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02439:Ndufa5 APN 6 24519202 missense probably damaging 1.00
BB004:Ndufa5 UTSW 6 24527292 missense possibly damaging 0.89
BB014:Ndufa5 UTSW 6 24527292 missense possibly damaging 0.89
R0441:Ndufa5 UTSW 6 24522751 missense probably benign 0.30
R0609:Ndufa5 UTSW 6 24519249 missense possibly damaging 0.95
R4891:Ndufa5 UTSW 6 24519247 missense possibly damaging 0.67
R7014:Ndufa5 UTSW 6 24519191 critical splice donor site probably null
R7927:Ndufa5 UTSW 6 24527292 missense possibly damaging 0.89
R8139:Ndufa5 UTSW 6 24522758 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATGCTCACTGTGTGACATTG -3'
(R):5'- GTGTTCTAGCAGTTAACTTCTTGCC -3'

Sequencing Primer
(F):5'- GTGCCAGTGCTAAAGGACTC -3'
(R):5'- GCCATTATTCTGAAAATACCTCTGG -3'
Posted On2019-11-12