Incidental Mutation 'R7661:Lrrc4'
ID591561
Institutional Source Beutler Lab
Gene Symbol Lrrc4
Ensembl Gene ENSMUSG00000049939
Gene Nameleucine rich repeat containing 4
SynonymsNLG-2, Nag14, NGL-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R7661 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location28661831-28831747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28829763 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 618 (T618A)
Ref Sequence ENSEMBL: ENSMUSP00000062158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000062304] [ENSMUST00000164915] [ENSMUST00000167201] [ENSMUST00000171353]
Predicted Effect probably benign
Transcript: ENSMUST00000001460
SMART Domains Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SNc 525 660 3.82e-45 SMART
TUDOR 728 785 4.8e-19 SMART
Pfam:SNase 835 895 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062304
AA Change: T618A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062158
Gene: ENSMUSG00000049939
AA Change: T618A

DomainStartEndE-ValueType
low complexity region 32 40 N/A INTRINSIC
LRRNT 44 78 4.05e-5 SMART
LRR 72 96 1.19e2 SMART
LRR_TYP 97 120 2.24e-3 SMART
LRR 121 144 6.13e-1 SMART
LRR_TYP 145 168 5.99e-4 SMART
LRR 216 239 1.25e-1 SMART
LRR 240 263 4.71e1 SMART
LRR_TYP 264 287 2.79e-4 SMART
LRRCT 299 350 8.06e-6 SMART
IGc2 364 430 5.24e-7 SMART
low complexity region 452 462 N/A INTRINSIC
transmembrane domain 527 549 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164915
SMART Domains Protein: ENSMUSP00000127317
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 142 1.56e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167201
SMART Domains Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SCOP:d1sty__ 526 592 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171353
SMART Domains Protein: ENSMUSP00000129497
Gene: ENSMUSG00000049939

DomainStartEndE-ValueType
low complexity region 29 39 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is significantly downregulated in primary brain tumors. The exact function of the protein encoded by this gene is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity, an absence of startle reflex, and abnormal ABR amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Lrrc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:Lrrc4 APN 6 28830880 missense probably damaging 0.99
IGL03223:Lrrc4 APN 6 28831470 missense probably damaging 1.00
IGL03410:Lrrc4 APN 6 28830516 missense probably damaging 1.00
R0233:Lrrc4 UTSW 6 28829735 missense probably benign 0.05
R0233:Lrrc4 UTSW 6 28829735 missense probably benign 0.05
R0456:Lrrc4 UTSW 6 28831104 missense probably damaging 1.00
R1162:Lrrc4 UTSW 6 28831084 missense probably damaging 1.00
R2001:Lrrc4 UTSW 6 28830905 missense probably damaging 1.00
R2089:Lrrc4 UTSW 6 28830587 missense probably benign 0.45
R2091:Lrrc4 UTSW 6 28830587 missense probably benign 0.45
R2091:Lrrc4 UTSW 6 28830587 missense probably benign 0.45
R2353:Lrrc4 UTSW 6 28831452 missense probably benign 0.00
R5079:Lrrc4 UTSW 6 28830770 missense possibly damaging 0.69
R5197:Lrrc4 UTSW 6 28830143 missense probably damaging 1.00
R6701:Lrrc4 UTSW 6 28830906 missense possibly damaging 0.95
R6755:Lrrc4 UTSW 6 28831293 missense probably damaging 1.00
R7660:Lrrc4 UTSW 6 28829817 missense probably benign 0.00
R8113:Lrrc4 UTSW 6 28829903 missense probably damaging 0.97
R8272:Lrrc4 UTSW 6 28662193 missense unknown
Predicted Primers PCR Primer
(F):5'- CTCCCCACTCTGTACAAAAGTTG -3'
(R):5'- CTGCTGCCATGTTGATTGTC -3'

Sequencing Primer
(F):5'- GAGTTTCCTGTACCTTGTCC -3'
(R):5'- GTCTTCTATAAACTTCGCAAGCGG -3'
Posted On2019-11-12