Incidental Mutation 'R7675:Cldn1'
ID 592435
Institutional Source Beutler Lab
Gene Symbol Cldn1
Ensembl Gene ENSMUSG00000022512
Gene Name claudin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7675 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 26356642-26371841 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26371511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 39 (N39S)
Ref Sequence ENSEMBL: ENSMUSP00000023154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023154]
AlphaFold O88551
Predicted Effect probably benign
Transcript: ENSMUST00000023154
AA Change: N39S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023154
Gene: ENSMUSG00000022512
AA Change: N39S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 2e-54 PFAM
Pfam:Claudin_2 15 184 4.4e-10 PFAM
low complexity region 187 205 N/A INTRINSIC
Meta Mutation Damage Score 0.4279 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (28/29)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The knockout mice lacking this gene die soon after birth as a consequence of dehydration from trandermal water loss, indicating that this gene is indispensable for creating and maintaining the epidermal barrier. The protein encoded by this gene also has gastric tumor suppressive activity, and is a key factor for hepatitis C virus (HCV) entry. [provided by RefSeq, Aug 2010]
PHENOTYPE: Animals homozygous for a mutation in this gene have wrinkled skin and die within 1 day after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik T C 5: 93,213,374 S96P unknown Het
5730559C18Rik G T 1: 136,216,003 A565E probably benign Het
Acaca A G 11: 84,315,916 E1534G probably benign Het
Adam7 A T 14: 68,499,853 D773E probably benign Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cacna1s T A 1: 136,110,874 I1398N probably damaging Het
Calu C T 6: 29,356,517 T14I probably benign Het
Casp8 A G 1: 58,823,947 D2G possibly damaging Het
Clspn T C 4: 126,566,320 S447P probably benign Het
Eef2k A G 7: 120,858,504 T29A probably benign Het
Elmsan1 G T 12: 84,173,800 P127T probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm9844 A T 7: 24,862,359 T28S probably benign Het
Gucy2c A G 6: 136,716,032 V723A possibly damaging Het
Ighv1-69 A T 12: 115,623,589 W3R probably damaging Het
Krtap16-1 A G 11: 99,985,433 C382R possibly damaging Het
Lrrc8a G A 2: 30,255,668 D165N probably damaging Het
Naaladl2 T A 3: 24,551,652 M148L probably benign Het
Nphp3 A T 9: 104,016,088 E424D probably benign Het
Prpf40a T C 2: 53,145,636 K714R possibly damaging Het
Ptpn23 A T 9: 110,387,026 L1254* probably null Het
Sap30l A G 11: 57,810,041 K174E probably damaging Het
Serpinb9d C T 13: 33,202,776 Q276* probably null Het
Tex14 A G 11: 87,509,678 D432G probably damaging Het
Unc119 G A 11: 78,343,597 G11R probably damaging Het
Usp36 A G 11: 118,263,696 V965A probably benign Het
Vmn2r4 A T 3: 64,415,236 Y21N probably benign Het
Zbtb38 G T 9: 96,685,541 D1163E probably benign Het
Zfp62 A G 11: 49,216,020 I313V possibly damaging Het
Zfp980 C T 4: 145,701,594 Q298* probably null Het
Other mutations in Cldn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Cldn1 APN 16 26371572 missense possibly damaging 0.59
IGL02937:Cldn1 APN 16 26360873 missense probably damaging 1.00
R1626:Cldn1 UTSW 16 26371452 missense probably damaging 1.00
R2131:Cldn1 UTSW 16 26371550 missense probably damaging 0.98
R2264:Cldn1 UTSW 16 26359199 missense probably damaging 1.00
R3778:Cldn1 UTSW 16 26371466 missense probably damaging 1.00
R4850:Cldn1 UTSW 16 26363163 missense probably benign 0.04
R5711:Cldn1 UTSW 16 26371417 missense probably damaging 1.00
R5753:Cldn1 UTSW 16 26363121 missense probably benign 0.01
R6017:Cldn1 UTSW 16 26363219 missense probably damaging 1.00
R7134:Cldn1 UTSW 16 26371626 start codon destroyed probably null 0.98
R7199:Cldn1 UTSW 16 26371596 missense probably benign 0.06
R7373:Cldn1 UTSW 16 26360856 missense probably damaging 1.00
R7600:Cldn1 UTSW 16 26360919 missense probably benign
R8840:Cldn1 UTSW 16 26371536 missense possibly damaging 0.61
R9489:Cldn1 UTSW 16 26363174 missense probably damaging 1.00
R9508:Cldn1 UTSW 16 26360869 nonsense probably null
R9605:Cldn1 UTSW 16 26363174 missense probably damaging 1.00
Z1177:Cldn1 UTSW 16 26360864 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACTACAGAGGACAAGGGCTCC -3'
(R):5'- TGTTTGCAGAGACCCCATCAC -3'

Sequencing Primer
(F):5'- ACAAGGGCTCCAAGGCTG -3'
(R):5'- GTGCGCACCTTGCAAACTC -3'
Posted On 2019-11-12