Incidental Mutation 'R7675:Elmsan1'
ID592431
Institutional Source Beutler Lab
Gene Symbol Elmsan1
Ensembl Gene ENSMUSG00000042507
Gene NameELM2 and Myb/SANT-like domain containing 1
Synonyms9430029N19Rik, C130039O16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R7675 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location84149176-84218881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 84173800 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 127 (P127T)
Ref Sequence ENSEMBL: ENSMUSP00000048120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046266] [ENSMUST00000110294] [ENSMUST00000220974]
Predicted Effect probably damaging
Transcript: ENSMUST00000046266
AA Change: P127T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048120
Gene: ENSMUSG00000042507
AA Change: P127T

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110294
AA Change: P127T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105923
Gene: ENSMUSG00000042507
AA Change: P127T

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220974
AA Change: P127T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (28/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik T C 5: 93,213,374 S96P unknown Het
5730559C18Rik G T 1: 136,216,003 A565E probably benign Het
Acaca A G 11: 84,315,916 E1534G probably benign Het
Adam7 A T 14: 68,499,853 D773E probably benign Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cacna1s T A 1: 136,110,874 I1398N probably damaging Het
Calu C T 6: 29,356,517 T14I probably benign Het
Casp8 A G 1: 58,823,947 D2G possibly damaging Het
Cldn1 T C 16: 26,371,511 N39S probably benign Het
Clspn T C 4: 126,566,320 S447P probably benign Het
Eef2k A G 7: 120,858,504 T29A probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm9844 A T 7: 24,862,359 T28S probably benign Het
Gucy2c A G 6: 136,716,032 V723A possibly damaging Het
Ighv1-69 A T 12: 115,623,589 W3R probably damaging Het
Krtap16-1 A G 11: 99,985,433 C382R possibly damaging Het
Lrrc8a G A 2: 30,255,668 D165N probably damaging Het
Naaladl2 T A 3: 24,551,652 M148L probably benign Het
Nphp3 A T 9: 104,016,088 E424D probably benign Het
Prpf40a T C 2: 53,145,636 K714R possibly damaging Het
Ptpn23 A T 9: 110,387,026 L1254* probably null Het
Sap30l A G 11: 57,810,041 K174E probably damaging Het
Serpinb9d C T 13: 33,202,776 Q276* probably null Het
Tex14 A G 11: 87,509,678 D432G probably damaging Het
Unc119 G A 11: 78,343,597 G11R probably damaging Het
Usp36 A G 11: 118,263,696 V965A probably benign Het
Vmn2r4 A T 3: 64,415,236 Y21N probably benign Het
Zbtb38 G T 9: 96,685,541 D1163E probably benign Het
Zfp62 A G 11: 49,216,020 I313V possibly damaging Het
Zfp980 C T 4: 145,701,594 Q298* probably null Het
Other mutations in Elmsan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Elmsan1 APN 12 84172855 nonsense probably null
IGL00913:Elmsan1 APN 12 84172858 missense probably benign
IGL00944:Elmsan1 APN 12 84160548 splice site probably benign
IGL01108:Elmsan1 APN 12 84173691 missense probably damaging 1.00
IGL01952:Elmsan1 APN 12 84173266 missense probably benign 0.00
IGL01961:Elmsan1 APN 12 84173614 missense probably damaging 1.00
IGL02188:Elmsan1 APN 12 84162326 missense probably benign 0.00
IGL02700:Elmsan1 APN 12 84152862 missense probably benign 0.06
R0645:Elmsan1 UTSW 12 84158303 missense possibly damaging 0.71
R1387:Elmsan1 UTSW 12 84152931 missense probably damaging 0.98
R1740:Elmsan1 UTSW 12 84172902 missense probably damaging 0.99
R1769:Elmsan1 UTSW 12 84158350 splice site probably benign
R1795:Elmsan1 UTSW 12 84158974 critical splice donor site probably null
R2146:Elmsan1 UTSW 12 84173035 missense probably damaging 0.99
R2872:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R2872:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R2940:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3408:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3689:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3691:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3840:Elmsan1 UTSW 12 84171609 missense probably damaging 0.99
R4364:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4366:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4392:Elmsan1 UTSW 12 84173111 missense probably benign 0.10
R4439:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4440:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4496:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R5227:Elmsan1 UTSW 12 84152887 missense probably benign 0.10
R6921:Elmsan1 UTSW 12 84156459 missense probably damaging 0.99
R8956:Elmsan1 UTSW 12 84162328 missense probably benign
Z1176:Elmsan1 UTSW 12 84173499 missense probably damaging 0.99
Z1176:Elmsan1 UTSW 12 84173501 missense probably damaging 0.98
Z1177:Elmsan1 UTSW 12 84152991 missense probably benign 0.01
Z1177:Elmsan1 UTSW 12 84162358 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTTGGCTGCATGGAAAGAG -3'
(R):5'- CTCTCCTGAACAGTGTGGTG -3'

Sequencing Primer
(F):5'- ACCTTCTGTGGCACCATGG -3'
(R):5'- TGTATGGATCTGAGAGGACCAC -3'
Posted On2019-11-12