Incidental Mutation 'R7675:Usp36'
ID 592430
Institutional Source Beutler Lab
Gene Symbol Usp36
Ensembl Gene ENSMUSG00000033909
Gene Name ubiquitin specific peptidase 36
Synonyms 2700002L06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock # R7675 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 118259651-118290244 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118263696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 965 (V965A)
Ref Sequence ENSEMBL: ENSMUSP00000090036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]
AlphaFold B1AQJ2
Predicted Effect probably benign
Transcript: ENSMUST00000092382
AA Change: V965A

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: V965A

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.6e-55 PFAM
Pfam:UCH_1 122 402 3.6e-26 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106296
AA Change: V965A

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: V965A

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.1e-49 PFAM
Pfam:UCH_1 122 402 2.2e-23 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144153
AA Change: V800A

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909
AA Change: V800A

DomainStartEndE-ValueType
Pfam:UCH 1 255 1e-40 PFAM
Pfam:UCH_1 4 237 2.9e-17 PFAM
low complexity region 375 393 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 768 778 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (28/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik T C 5: 93,213,374 S96P unknown Het
5730559C18Rik G T 1: 136,216,003 A565E probably benign Het
Acaca A G 11: 84,315,916 E1534G probably benign Het
Adam7 A T 14: 68,499,853 D773E probably benign Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cacna1s T A 1: 136,110,874 I1398N probably damaging Het
Calu C T 6: 29,356,517 T14I probably benign Het
Casp8 A G 1: 58,823,947 D2G possibly damaging Het
Cldn1 T C 16: 26,371,511 N39S probably benign Het
Clspn T C 4: 126,566,320 S447P probably benign Het
Eef2k A G 7: 120,858,504 T29A probably benign Het
Elmsan1 G T 12: 84,173,800 P127T probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm9844 A T 7: 24,862,359 T28S probably benign Het
Gucy2c A G 6: 136,716,032 V723A possibly damaging Het
Ighv1-69 A T 12: 115,623,589 W3R probably damaging Het
Krtap16-1 A G 11: 99,985,433 C382R possibly damaging Het
Lrrc8a G A 2: 30,255,668 D165N probably damaging Het
Naaladl2 T A 3: 24,551,652 M148L probably benign Het
Nphp3 A T 9: 104,016,088 E424D probably benign Het
Prpf40a T C 2: 53,145,636 K714R possibly damaging Het
Ptpn23 A T 9: 110,387,026 L1254* probably null Het
Sap30l A G 11: 57,810,041 K174E probably damaging Het
Serpinb9d C T 13: 33,202,776 Q276* probably null Het
Tex14 A G 11: 87,509,678 D432G probably damaging Het
Unc119 G A 11: 78,343,597 G11R probably damaging Het
Vmn2r4 A T 3: 64,415,236 Y21N probably benign Het
Zbtb38 G T 9: 96,685,541 D1163E probably benign Het
Zfp62 A G 11: 49,216,020 I313V possibly damaging Het
Zfp980 C T 4: 145,701,594 Q298* probably null Het
Other mutations in Usp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Usp36 APN 11 118264820 missense possibly damaging 0.76
IGL01115:Usp36 APN 11 118285960 missense probably damaging 1.00
IGL01720:Usp36 APN 11 118275002 missense probably damaging 0.99
IGL02410:Usp36 APN 11 118276185 missense probably damaging 1.00
IGL02700:Usp36 APN 11 118276157 missense possibly damaging 0.95
IGL02926:Usp36 APN 11 118264783 missense probably benign 0.22
IGL03145:Usp36 APN 11 118279241 missense probably damaging 1.00
IGL03203:Usp36 APN 11 118285810 missense probably benign 0.42
IGL03265:Usp36 APN 11 118264809 missense possibly damaging 0.65
R0482:Usp36 UTSW 11 118265194 missense probably benign 0.21
R0499:Usp36 UTSW 11 118273571 missense probably damaging 0.98
R0606:Usp36 UTSW 11 118263028 splice site probably benign
R0646:Usp36 UTSW 11 118273021 missense probably damaging 1.00
R1579:Usp36 UTSW 11 118284945 missense probably damaging 1.00
R1646:Usp36 UTSW 11 118273566 missense probably damaging 1.00
R1716:Usp36 UTSW 11 118272131 critical splice donor site probably null
R1886:Usp36 UTSW 11 118272958 missense probably damaging 1.00
R2014:Usp36 UTSW 11 118262508 splice site probably benign
R2068:Usp36 UTSW 11 118275018 missense possibly damaging 0.80
R2146:Usp36 UTSW 11 118268665 missense probably benign 0.02
R2191:Usp36 UTSW 11 118285023 missense possibly damaging 0.95
R2899:Usp36 UTSW 11 118276756 splice site probably benign
R3176:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3177:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3276:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3277:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3615:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3616:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3768:Usp36 UTSW 11 118263052 missense probably damaging 1.00
R3899:Usp36 UTSW 11 118279824 missense possibly damaging 0.90
R3900:Usp36 UTSW 11 118279824 missense possibly damaging 0.90
R4484:Usp36 UTSW 11 118285795 missense probably damaging 0.99
R4809:Usp36 UTSW 11 118263070 missense probably damaging 1.00
R5135:Usp36 UTSW 11 118264905 missense possibly damaging 0.58
R5323:Usp36 UTSW 11 118265194 missense probably benign 0.21
R6226:Usp36 UTSW 11 118277274 missense probably damaging 1.00
R6266:Usp36 UTSW 11 118268585 missense probably damaging 1.00
R7191:Usp36 UTSW 11 118268834 missense probably benign 0.39
R7215:Usp36 UTSW 11 118265154 missense possibly damaging 0.87
R7289:Usp36 UTSW 11 118273529 missense probably damaging 1.00
R7535:Usp36 UTSW 11 118262046 missense possibly damaging 0.92
R7843:Usp36 UTSW 11 118285965 missense probably damaging 1.00
R8228:Usp36 UTSW 11 118264890 missense possibly damaging 0.77
R8902:Usp36 UTSW 11 118275014 missense probably damaging 1.00
R8935:Usp36 UTSW 11 118276831 critical splice acceptor site probably null
R8995:Usp36 UTSW 11 118284999 missense probably damaging 1.00
R9024:Usp36 UTSW 11 118276157 missense possibly damaging 0.95
R9325:Usp36 UTSW 11 118269205 missense possibly damaging 0.69
R9529:Usp36 UTSW 11 118268635 nonsense probably null
R9774:Usp36 UTSW 11 118263049 missense probably damaging 1.00
X0020:Usp36 UTSW 11 118273613 missense probably damaging 1.00
Z1177:Usp36 UTSW 11 118276200 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTAGGTATTTGCTAGCAACTGATG -3'
(R):5'- CACTGAAGGTGGTGCTCTTG -3'

Sequencing Primer
(F):5'- TTGCTAGCAACTGATGGAAACCTG -3'
(R):5'- TGCCTACAGTGTTTCTCAAGG -3'
Posted On 2019-11-12