Mutagenetix > Incidental Mutations

Incidental Mutation 'R7699:Pdlim1'

593900

Institutional Source

Beutler Lab

Gene Symbol

Pdlim1

Ensembl Gene

ENSMUSG00000055044

Gene Name

PDZ and LIM domain 1 (elfin)

Synonyms

CLP36, mClim1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7699 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40221173-40271842 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 40249658 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 98 (K98N)

Ref Sequence

ENSEMBL: ENSMUSP00000064545 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068439] [ENSMUST00000182432]

Predicted Effect

probably damaging
Transcript: ENSMUST00000068439
AA Change: K98N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000064545
Gene: ENSMUSG00000055044
AA Change: K98N

Domain	Start	End	E-Value	Type
PDZ	12	85	3.23e-18	SMART
Pfam:DUF4749	136	234	4.6e-29	PFAM
LIM	257	308	2.31e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182432
AA Change: K98N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138383
Gene: ENSMUSG00000055044
AA Change: K98N

Domain	Start	End	E-Value	Type
PDZ	12	85	3.23e-18	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the enigma protein family. The protein contains two protein interacting domains, a PDZ domain at the amino terminal end and one to three LIM domains at the carboxyl terminal. It is a cytoplasmic protein associated with the cytoskeleton. The protein may function as an adapter to bring other LIM-interacting proteins to the cytoskeleton. Pseudogenes associated with this gene are located on chromosomes 3, 14 and 17. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit enhanced platelet response to GPVI agonists and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810009A15Rik	T	C	19: 8,890,053	L72P	probably benign	Het
4930407I10Rik	C	A	15: 82,064,105	H734Q	probably benign	Het
4932438A13Rik	T	A	3: 36,974,172	N2329K	possibly damaging	Het
4932438A13Rik	C	T	3: 37,026,154	S267L	probably benign	Het
Acadl	A	G	1: 66,838,363	V343A	possibly damaging	Het
Acot4	A	T	12: 84,043,237	D236V	probably damaging	Het
App	T	A	16: 85,040,309		probably null	Het
Arfgef1	G	A	1: 10,194,411	T470I	possibly damaging	Het
Arhgef5	T	C	6: 43,274,757	I814T	probably benign	Het
Atr	A	T	9: 95,875,690	R968*	probably null	Het
C130060K24Rik	T	A	6: 65,452,956	I212N	probably benign	Het
Capn7	C	T	14: 31,352,444	T268I	probably benign	Het
Cbwd1	A	G	19: 24,942,681		probably null	Het
Cubn	A	T	2: 13,348,178	F1916L	probably benign	Het
Cubn	A	G	2: 13,489,917	V107A	possibly damaging	Het
Cyp11b1	T	A	15: 74,835,842	T473S	probably damaging	Het
Cyr61	C	T	3: 145,648,692	G155R	probably damaging	Het
Dip2c	T	G	13: 9,659,311	S1396A	probably benign	Het
Dyrk1b	T	C	7: 28,184,312	Y198H	probably damaging	Het
Echdc2	G	T	4: 108,174,077	R206L	probably benign	Het
Ep400	C	T	5: 110,696,032	R1594Q	unknown	Het
Fmnl2	G	A	2: 53,036,508	R69Q		Het
Fry	T	A	5: 150,405,327	H1308Q	probably damaging	Het
Fyb2	T	A	4: 105,010,454	D667E	probably benign	Het
Gimap7	T	A	6: 48,723,857	Y126N	possibly damaging	Het
Gm1979	A	T	5: 26,000,180	W266R	probably damaging	Het
Gm28042	T	A	2: 120,039,716	M712K	possibly damaging	Het
Gm3238	A	G	10: 77,770,635	*231R	probably null	Het
Gm5592	C	A	7: 41,286,407	A111E	probably damaging	Het
Gm7694	A	G	1: 170,301,148	*271Q	probably null	Het
Ift81	T	C	5: 122,594,560	M304V	possibly damaging	Het
Igfals	T	C	17: 24,880,574	L213P	probably damaging	Het
Ints3	G	A	3: 90,421,804	P83S	probably benign	Het
Kcna10	T	G	3: 107,195,540	S496A	probably damaging	Het
Kmt2d	G	A	15: 98,843,719	A4520V	unknown	Het
Lemd3	A	T	10: 120,978,090	Y413N	probably damaging	Het
Lgr6	T	C	1: 134,996,032	N453S	probably damaging	Het
Lmtk3	A	C	7: 45,792,574	D352A	probably damaging	Het
Lrrc4c	T	C	2: 97,630,679	M550T	possibly damaging	Het
Maml2	A	T	9: 13,621,089	Q533L		Het
Mdn1	T	A	4: 32,741,344	D3815E	probably damaging	Het
Megf8	C	T	7: 25,329,928	A299V	possibly damaging	Het
Meis3	G	T	7: 16,177,556	E59D	probably benign	Het
Mppe1	A	G	18: 67,225,704	*398R	probably null	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Mtus1	T	A	8: 41,083,969	T237S	possibly damaging	Het
Ndfip2	T	A	14: 105,287,759	V158E	possibly damaging	Het
Nrbp2	T	G	15: 76,090,897	T53P	probably damaging	Het
Nrde2	G	A	12: 100,130,835	P902L	probably benign	Het
Olfr1383	A	G	11: 49,524,554	Y277C	probably damaging	Het
Olfr509	T	A	7: 108,645,672	K301N	probably damaging	Het
Olfr642	T	A	7: 104,050,593		probably benign	Het
Olfr739	T	A	14: 50,425,335	M272K	probably benign	Het
Olfr771	T	C	10: 129,160,055	M310V	probably benign	Het
Pcdha1	A	G	18: 36,931,062	T260A	probably damaging	Het
Phrf1	G	A	7: 141,254,929	G207R	unknown	Het
Pik3r6	A	G	11: 68,528,563	K124R	probably damaging	Het
Polr2b	T	A	5: 77,340,421	F823I	probably benign	Het
Prss58	T	C	6: 40,895,388	I234V	probably damaging	Het
Ptpn14	A	T	1: 189,865,411	N766I	probably benign	Het
Repin1	T	A	6: 48,597,822	S562T	probably damaging	Het
Rgr	C	T	14: 37,044,595	D165N	probably damaging	Het
Rho	T	C	6: 115,935,239	F221L	probably damaging	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnase2a	A	G	14: 51,255,791	I39T	probably damaging	Het
Rpl13a	T	G	7: 45,127,236	I43L	probably benign	Het
Rpp30	T	C	19: 36,089,158	V97A	probably benign	Het
Scube3	T	C	17: 28,167,049	Y755H	probably damaging	Het
Sec24a	A	T	11: 51,712,257	V788E	probably damaging	Het
Spns2	A	T	11: 72,489,617	L60*	probably null	Het
Strc	T	C	2: 121,371,748	N1213S	possibly damaging	Het
Tec	A	T	5: 72,786,024	I116N	possibly damaging	Het
Tll1	A	T	8: 64,093,954	D319E	probably benign	Het
Tmem121b	T	C	6: 120,493,427	T110A	unknown	Het
Tmem232	T	A	17: 65,265,218	I593F	probably damaging	Het
Tpp2	A	G	1: 43,970,466	I487V	probably benign	Het
Ubr4	C	A	4: 139,408,867	C934*	probably null	Het
Vmn1r68	A	G	7: 10,527,632	Y180H	probably benign	Het
Vmn2r25	T	C	6: 123,839,923	D233G	possibly damaging	Het
Wdr6	A	G	9: 108,576,361	W108R	possibly damaging	Het

Other mutations in Pdlim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02027:Pdlim1	APN	19	40243466	missense	probably benign	0.00
IGL02253:Pdlim1	APN	19	40230530	missense	probably damaging	0.99
IGL02312:Pdlim1	APN	19	40223061	missense	probably benign	0.00
IGL02584:Pdlim1	APN	19	40243400	splice site	probably null
R0391:Pdlim1	UTSW	19	40243573	missense	probably damaging	0.99
R1554:Pdlim1	UTSW	19	40223072	missense	probably benign	0.19
R1751:Pdlim1	UTSW	19	40251904	splice site	probably benign
R1972:Pdlim1	UTSW	19	40223137	missense	probably damaging	0.99
R2900:Pdlim1	UTSW	19	40223075	missense	probably damaging	1.00
R4709:Pdlim1	UTSW	19	40222736	missense	probably benign	0.26
R4803:Pdlim1	UTSW	19	40243448	missense	possibly damaging	0.94
R4818:Pdlim1	UTSW	19	40223136	missense	probably damaging	0.98
R5360:Pdlim1	UTSW	19	40230549	missense	probably damaging	0.99
R5833:Pdlim1	UTSW	19	40230545	missense	probably damaging	1.00
R6547:Pdlim1	UTSW	19	40223120	missense	probably damaging	0.97
R7700:Pdlim1	UTSW	19	40249658	missense	probably damaging	0.99
R7756:Pdlim1	UTSW	19	40243542	missense	probably benign	0.00
R7758:Pdlim1	UTSW	19	40243542	missense	probably benign	0.00
R7914:Pdlim1	UTSW	19	40252001	missense	probably damaging	0.98
R8201:Pdlim1	UTSW	19	40230514	missense	probably benign
R8331:Pdlim1	UTSW	19	40230551	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- ATCCCAGCAATGACAGTGG -3'
(R):5'- ACAGAGGTTGAGCTGGATCC -3'

Sequencing Primer
(F):5'- AATGACAGTGGAGGCCTCTC -3'
(R):5'- TGAGACAGCAGCTTTAGGC -3'

Posted On

2019-11-12